transport of glutathione conjugated redox compounds to the kidney as a common factor in chemical induced nephrocarcinogenicity
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... Table p27 and cyclin E statistical associations p27 Cyclin E All invasive carcinomas Infiltrating duct carcinomas only All invasive carcinomas Infiltrating duct carcinomas only Distant metastases ... receptor status in invasive ductal and lobular carcinomas [9] But the labelling index of cyclin D1 correlated with the pathological stage of the disease in invasive lobular carcinomas but not in invasive ... [24] In this study, there was a significant association of age, grade, lymph node spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup...
- 9
- 423
- 0
Báo cáo khoa học: "Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium and ventricle in a pacemaker-dependent patient" pps
... treatment of cardiac metastases encasing the leads of a pacemaker, and of cardiac metastases from ATCs, with a review of the pertinent literature Background Anaplastic thyroid carcinoma (ATC) ... cardiac metastases from from ATCs, and of mural metastases encasing the leads of a pacemaker Case The patient is an 80 year old male with a past medical history of atrial fibrillation with sinus ... cancers, including melanoma, bladder[4], sarcoma[5], lung, lymphoma, breast carcinoma[6] and cervix [7] Cardiac metastases from primary anaplastic thyroid carcinoma are rare - an autopsy series has...
- 8
- 328
- 0
Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx
... Each case was classified according to the clinical TNM staging of canine mammary tumors modified from the World Health Organization [24] All patients underwent either by lumpectomy or mastectomy ... inactivation occurred prior to invasion in breast carcinogenesis, with mutations being uniformly identified in ductal carcinoma in situ associated with p53-mutated invasive carcinomas Immunohistochemical ... performed The quality of each immunohistochemically stain was assessed by comparing the sections with an accompanying positive control slide A tumor sample was regarded as p53 positive if nuclear staining...
- 7
- 325
- 0
báo cáo khoa học:" The ICF as a common language for rehabilitation goal-setting: comparing client and professional priorities" ppt
... study was to determine the effectiveness of the screening materials and the interview schedule and (Talking Mats™ and the line drawings) The material and procedural efficacy was also assessed and ... discrimination task, a grid with six PCS line drawings was compiled In the screening protocol it was assumed that the participant would be able to place a card with a specific line drawing onto the ... the purpose of data analysis results obtained from each of the participant groups was analysed individually Thereafter a Friedman analysis [19] was used to explore the difference in ratings of...
- 9
- 323
- 0
Báo cáo y học: "Allometric scaling of the maximum metabolic rate of mammals: oxygen transport from the lungs to the heart is a limiting step" pdf
... veins are dilated, this pressure difference is predicted to increase by a factor of approximately during heavy exercise in a trained athlete when cardiac output increases by a factor of (assuming ... value of Πmax is assumed to be approximately the same in mammals of different sizes because Πo appears to be nearly invariant in mammalian species, being approxi- Page of (page number not for citation ... California; 2003 Agur AM, Ming JL, Grant JC: Grant's Atlas of Anatomy Baltimore: Lippincott, Williams and Williams; 2004 Bergman RA, Afifi AK, Heidger PM: Atlas of Microscopic Anatomy Philadelphia:...
- 8
- 287
- 0
Sensibility study of flooding and drying issues to the operating conditions in PEM fuel cells
... multi-component gas transport in the gas diffusion layers and in the bipolar plate channels It also describes water transport in the membrane This model is used to analyze the role that each operating parameters ... concentration results in a decrease of the current density Moreover, there are also cases where the current increases in a first part of the channel, reaches a maximum, and then decreases further along ... progressing through the channel to the outlet point B, water vapor content in the gas increases due to water production at the cathode In addition, the water content increases from the channel to the...
- 20
- 571
- 0
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCAC TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTT CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTA CTCGAGGAATCAGCATTCAG ... Sense Antisense CCCAAGCTTGGGATGGCGAACCTTGGCTGCT CGGGATCCTCCCACATCAGGAAGATGAGGA TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTT CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAA TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT ... Demographic and clinicopathological information was obtained from our population-based database, and tumor staging was carried out for each case according to the classification at the time of surgery...
- 10
- 448
- 0
Báo cáo Y học: Binding of Thermomyces (Humicola) lanuginosa lipase to the mixed micelles of cis-parinaric acid/NaTDC Fluorescence resonance energy transfer and crystallographic study ppt
... (kmax), as well as the increase of RFI (%), measured at 410 nm, as a function of cis-PnA concentration are presented in Fig A good quantitative correlation between increase and decrease of RFI as ... amounts of NaTDC (data not shown) The results obtained using cis-PnA as a fluorescent reporter, indicate that the increase in the cis-PnA fluorescence intensity was due to its incorporation into ... centrifugation in a Sigma Eppendorf centrifuge (5 min, 18 000 g) and the remaining protein was used in the crystallization experiments NaTDC was added to the crystallization trials separately at a concentration...
- 9
- 424
- 0
Báo cáo khoa học: Kinetics of electron transfer from NADH to the Escherichia coli nitric oxide reductase flavorubredoxin pdf
... FlRd is the terminal component of an electron transport chain (Fig 1) that involves NADH and avorubredoxin reductase, a FAD-binding protein of the NAD(P)H:rubredoxin oxidoreductase family The genes ... the Rd-domain, making this an adequate wavelength range to monitor redox changes of the Rd centre in the whole enzyme The kinetics of FlRd reduction was investigated by anaerobically mixing the ... dioxygenase: an enzymic function for avohemoglobin Proc Natl Acad Sci USA 95, 1037810383 Wasserfallen A, Ragettli S, Jouanneau Y & Leisinger T (1998) A family of avoproteins in the domains Archaea and...
- 10
- 404
- 0
Báo cáo khoa học: Contributions of host and symbiont pigments to the coloration of reef corals pptx
... extend as far into the imidazolyl group of the chromophore as in other green -to- red photoconverting proteins, due to a noncoplanar arrangement of the imidazole moiety with the rest of the chromophore ... proteins are the most important pigments responsible for the orange–red coloration of Faviina and Meandriina corals Phycoerythrin was clearly excluded as a coloring compound in the above taxa In contrast, ... proteins mcavRFP (6) and EosFP (7) (A) Daylight photograph of an agarose plate with diffusing coral, algal and bacterial extracts Precipitates are highlighted by arrows and indicate the cross-reactivity...
- 8
- 470
- 1
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx
... b1fi2Mana1fi2Mana1fi2 a1 fi3Mana1fi2Mana1fi2Mana1fi2 ›6 Mana1 Mana1fi3 a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > > ›2 ›2 ›2 > > = Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > ›2 > > > a1 fi2Mana1 ; a1 fi6Mana1fi6Mana1fi6Mana1fi6 ... immunosorbent assay of Fr L The assay was carried out using the factor sera of Candida Check s, factor serum; d, factor serum; n, factor serum; m, factor serum; h, factor serum; j, factor 13b serum These ... a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 ›2 ›2 a1 fi2Mana1 Mana1fi2 Mana1fi6 a1 fi6Mana1fi6 a1 fi3Mana1fi2 Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2...
- 11
- 456
- 0
Báo cáo khoa học: Calcium-induced activation and truncation of promatrix metalloproteinase-9 linked to the core protein of chondroitin sulfate proteoglycans pot
... forms of the gelatinase, as well as the cABC degradation of the CS-chains of the PG The presence of 4.5 M urea in the proMMP-9/CSPG preparation had no effect on the position of the two main gelatinase ... to SDS/PAGE and the gel was analyzed by autoradiography No fragmentation of gelatin could be detected in the absence of CaCl2, while in the presence of 10 mM CaCl2, the gelatin was degraded to ... separating gel Fig Urea inhibits both the CaCl2 -induced release of low Mr forms of the gelatinase and cABC degradation of the CS-chains in the complex Four micrograms of purified CSPG was incubated...
- 12
- 381
- 0
Báo cáo khoa học: Differential binding of human immunoagents and Herceptin to the ErbB2 receptor ppt
... results The binding of Erbicin to ErbB2-ECD was found to be enhanced and stabilized by the linking of Erbicin scFv to either an RNase or the Fc antibody fragment, as in ERBhRNase and ERB-hcAb, respectively ... on the flow cell surfaces Surface plasmon resonance was also employed to carry out equilibrium binding analyses of Herceptin and ERB-hcAb, as bivalent analytes, and ERB-hRNase, as a monovalent analyte, ... induced at a later stage in treatment [7] Furthermore, it has been found that Herceptin can lead to cardiotoxicity in a significant fraction of treated patients [8,9] An alternative approach to...
- 13
- 367
- 0
university of california press from marriage to the market the transformation of womens lives and work aug 2006
... Runners, a group that has been together more than twenty-five years Early Saturday mornings we would run six miles and then all eat breakfast in the basement of a town building As we passed the halfway ... work, hastening its demise Rather than causing the breakdown of the male breadwinner family, the decline of the traditional manufacturing sector and the stagnation of men’s wages simply accelerated ... mills took the arduous task of making cloth out of the home, few further inroads were made into women’s household tasks Instead, initial emphasis was on creating an industrial base, through the...
- 311
- 412
- 0
university of california press a critical history of early rome from prehistory to the first punic war feb 2005
... power of all Italy Since the Apennines swing away from the Adriatic coast in southern Italy, turn toward the Tyrrhenian Sea, and terminate in the foot and toe of Bruttium, the southeastern coast ... streams, and empties into the Adriatic Since the land nearest the Po was often marshy, the earliest human inhabitants of northern Italy tended to settle in areas away from italy in prehistory the ... rites of the community, was the language of the people dwelling in the Apennines in an area south of the Po and bordering on Etruria The other major Sabellian dialect was Oscan, which was the speech...
- 421
- 379
- 0
báo cáo hóa học: " How do medical students value health on the EQ-5D? Evaluation of hypothetical health states compared to the general population" ppt
... for monitoring the health status of patient groups at different points in time: (1) for valuation and audit of health care, by measuring changes in health status in individual patients and in groups ... according to their individual perception In a next step the students marked each health state on a thermometer-style VAS according to its relative rank The VAS was bounded by the worst imaginable ... M, Ohinmaa A, de Charro F: Construction of the EQ-net VAS and TTO databases In The measurement and valuation of health status using EQ-5D: A European perspective Edited by: Brooks R, Rabin R,...
- 6
- 423
- 0
Báo cáo hóa học: " Research Article Convergence of Vectorial Continued Fractions Related to the Spectral Seminorm" docx
... continued fractions we can use the spectral seminorm of the algebra to include a large class of vectorial continued fractions First, we start by determining necessary conditions upon an and bn to ... convergence according to the spectral seminorm This result is an extension of von Koch Theorem , concerning the scalar case A similar theorem was given by Fair for vectorial continued fractions according ... also according to the norm because the spectral seminorm ρ satisfies ρ x ≤ x , ∀x ∈ A 1.10 In Section 3, we give another example of a vectorial continued fraction that converges according to the...
- 12
- 199
- 0
Báo cáo lâm nghiệp: " The response of weevil communities (Coleoptera: Curculionoidea) to the altitudinal zones of beech stands" ppt
... 18 easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy slope easy ... of the 3rd AZ the canonical axis (axis 1) explained 26.1%, axis 2 explained 68.5% and axis explained 65.8% of total variability in the species data 9.4% of total variability in the species data ... 20 Altitudinal zone Altitudinal zone Fig Ratio of weevil species in investigated AZ (%) first two unconstrained axes after axis explained more variability than the canonical axis in all cases and...
- 11
- 398
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25