Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

10 402 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 07/03/2014, 03:20

Inhibition of PI3K/Akt partially leads to the inhibition ofPrPC-induced drug resistance in gastric cancer cellsJie Liang*, Fulin Ge*, Changcun Guo, Guanhong Luo, Xin Wang, Guohong Han, Dexin Zhang,Jianhong Wang, Kai Li, Yanglin Pan, Liping Yao, Zhanxin Yin, Xuegang Guo, Kaichun Wu, Jie Dingand Daiming FanState Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Fourth Military Medical University, Xi’an, Shaanxi, ChinaCellular prion protein (PrPC) is a ubiquitous glyco-protein that is localized at the cell surface via aglycosyl-phosphatidylinositol-anchored membrane pro-tein, whose pathogenic isoform, PrPSc, has attractedworldwide attention due to its involvement in the path-ogenesis of bovine spongiform encephalopathy andCreutzfeldt–Jakob disease in human beings [1]. PrPCishighly conserved in mammalian species, and hasbeen postulated to be involved in one or more of thefollowing activities: neurotransmitter metabolism, celladhesion, signal transduction, antioxidant activity andprogrammed cell death [2]. However, the exact biologi-cal function of normal PrPCis still unknown [3].In our previous studies, PrPCwas identified as anupregulated gene in the adriamycin (ADR)-resistantgastric carcinoma cell line SGC7901/ADR comparedto its parental cell line SGC7901 by subtractive hybrid-ization and RT-PCR [4]. PrPCwas further found to beKeywordsdrug resistance; gastric cancer; P-gp;PI3K/Akt; prion proteinCorrespondenceJ. Ding, State Key Laboratory of CancerBiology and Xijing Hospital of DigestiveDiseases, Fourth Military Medical University,Xi’an 710032, ChinaFax: +86 29 82539041Tel: +86 29 84771504E-mail: dingjie@fmmu.edu.cnD. Fan, State Key Laboratory of CancerBiology and Xijing Hospital of DigestiveDiseases, Fourth Military Medical University,Xi’an 710032, ChinaFax: +86 29 82539041Tel: +86 29 84775221E-mail: fandaim@fmmu.edu.cn*These authors contributed equally to thiswork(Received 1 October 2008, revised 16November 2008, accepted 24 November2008)doi:10.1111/j.1742-4658.2008.06816.xCellular prion protein (PrPC), a glycosyl-phosphatidylinositol-anchoredmembrane protein with unclear physiological function, was previous foundto be upregulated in adriamycin (ADR)-resistant gastric carcinoma cell lineSGC7901/ADR compared to its parental cell line SGC7901. Overexpres-sion of PrPCin gastric cancer has certain effects on drug accumulationthrough upregulation of P-glycoprotein (P-gp), which is suggested to playan important role in determining the sensitivity of tumor cells to chemo-therapy and is linked to activation of the phosphatidylinositol-3-kinase/Akt(PI3K/Akt) pathway. In the present study, we further investigate the roleof the PI3K/Akt pathway in PrPC-induced multidrug-resistance (MDR) ingastric cancer. Immunohistochemistry and confocal microscope detectionsuggest a positive correlation between PrPCand phosphorylated Akt(p-Akt) expression in gastric cancer. Using established stable PrPCtransfec-tant cell lines, we demonstrated that the level of p-Akt was increased inPrPC-transfected cells. Inhibition of PrPCexpression by RNA interferenceresulted in decreased p-Akt expression. Inhibition of the PI3K/Akt path-way by one of its specific inhibitors, LY294002, or by Akt small interferingRNA (siRNA) resulted in decreased multidrug resistance of SGC7901 cells,partly through downregulation of P-gp induced by PrPC. Taken together,our results suggest that PrPC-induced MDR in gastric cancer is associatedwith activation of the PI3K/Akt pathway. Inhibition of PI3K/Akt byLY2940002 or Akt siRNA leads to inhibition of PrPC-induced drug resis-tance and P-gp upregulation in gastric cancer cells, indicating a possiblenovel mechanism by which PrPCregulates gastric cancer cell survival.AbbreviationsADR, adriamycin; IR, immunoreactivity; MDR, multidrug-resistance; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; P-gp,P-glycoprotein; PI3K/Akt, phosphatidylinositol-3-kinase/Akt; PrPC, cellular prion protein; siRNA, small interfering RNA; VCR, vincristine.FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 685highly expressed in the gastric cancer cell linesSGC7901/ADR and SGC7901/VCR. Its overexpres-sion played a certain role in drug accumulation ingastric cancer cells, which could induce drug resistancein SGC7901 cells by decreasing accumulation andincreasing release of these drugs (ADR and VCR) [5].PrPC-mediated multidrug resistance (MDR) wasthought to be related to upregulation of P-glycoprotein(P-gp) [6] and inhibition of apoptosis [6–9]; these stud-ies were the first reports that PrPCcan induce theMDR phenotype in gastric cancer cells.Activation of the phosphatidylinositol-3-kinase/Akt(PI3K/Akt) pathway is a critical step in determiningthe sensitivity of tumor cells to chemotherapy [10].A previous study demonstrated that MDR in gastriccancer could be reversed by downregulation of Akt1by Akt1 small interfering RNA (siRNA) [11]. Otherstudies strongly suggested that the PI3K/Akt path-way is involved in certain functions of PrP [12,13].Some differentially expressed genes involved in thePI3K/Akt pathway were found to be overexpressedin breast cancer cell line MCF7, together with17-fold upregulation of PrP [14].In present study, we hypothesized that the PI3K/Aktpathway is involved in PrPC-mediated MDR in gastriccancer. To test this hypothesis, the expression of Aktand PrPCwas examined by immunohistochemistry andconfocal microscope in human gastric cancer cases andcell lines. Expression of total and p-Akt was detected incells transfected with PrPC. The effects of PI3K/Akt onPrPC-induced MDR in gastric cancer were then exam-ined by a drug sensitivity assay that involved adding thePI3K/Akt-specific inhibitor LY294002 or co-transfec-tion with Akt siRNA. The underlying mechanisms werefurther explored by RT-PCR, Western blotting and theluciferase reporter assay.ResultsCo-expression of PrPCand Akt in gastric cancerImmunohistochemical staining showed that PrPCwasexpressed in the cytoplasm of neoplastic cells in 70.6%(60/85) of gastric cancer tissues. Although PrPCalsoshowed expression in adjacent nontumor gastric tissue,this was significantly lower than in gastric cancer cells(P < 0.05). Phosphorylated Akt (p-Akt) immuno-reactivity was observed in 88.2% (75/85) of gastriccancer tissues, with positive signals mainly in the cyto-plasm of neoplastic cells. As PrPCand p-Akt expres-sion coexisted in gastric cancer tissues, we analyzedtheir correlation in 60 cases of PrPC-positive gastriccancer tissues. Spearman analysis showed that therewas a significant correlation between PrPCand p-Aktimmunoreactivity, with rs = 0.514, P < 0.01 (Fig. 1A).The correlation of p-Akt with PrPCin gastric cancertissues suggests possible co-expression.To test this hypothesis, PrPCand p-Akt wereco-expressed in SGC7901/ADR cells. The yellow stain-ing in dual-labeling experiments indicated overlappingareas of red and green fluorescence, suggestingco-expression of p-Akt with PrPCin the cytoplasm ofSGC7901/ADR cells (Fig. 1B). These results suggesteda positive correlation between PrPCand p-Akt expres-sion in gastric cancer.Induced activation of p-Akt in PrPC-transfectedcellsOur previous work has shown that PrPCexpressionwas detected in several different histological types ofhuman gastric cancer cell lines, and is relatively low inSGC7901 cells and high in AGS. To upregulate ordownregulate PrPCexpression, the PRNP gene wasstably transfected into human gastric cancer cells ofline SGC7901 or blocked by siRNA in AGS. After celltransfection and antibiotic screening for more than2 months, multiple resistance clones were selected, andexpression of PrPCin the cells was confirmed by Wes-tern blotting (Fig. 2A). As close correlation of p-Aktwith PrPCwas found in gastric cancer tissues, we won-dered whether PrPCcould regulate the expression ofAkt in transfected cells. As shown in Fig. 2B, therewas higher expression of the phosphorylated form ofAkt (Thr308) in SGC7901 transfected with PrPC(SGC7901/PrPC) than in SGC7901 transfected withempty pcDNA3.1B (SGC7901/pcDNA3.1B) or non-transfected SGC7901, which did not affect the expres-sion of total Akt. As the siRNA affected translationbut not post-translational events, both the total andphosphorylated Akt levels decreased in AGS/PrPC(RNAi). These results indicate that alteration of PrPCexpression led to a corresponding change in the PI3K/Akt pathway in gastric cancer cells lines, and con-firmed that PrPCregulates the expression of p-Aktin vitro, consistent with the above in vivo findings.PI3K/Akt is involved in PrPC-mediated MDR ingastric cancerIn order to study whether activation of the PI3K/Aktsignaling pathway played a role in PrPC-induced MDRin gastric cancer cells, the PrPC-overexpressing cell lineand the corresponding controls were treated withLY294002, a selective inhibitor of PI3K, or byco-transfection with Akt siRNA [13]. The in vitroPI3K/Akt in PrPC-induced MDR J. Liang et al.686 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBSeffects of the anticancer drugs on the growth ofSGC7901/PrPC, SGC7901/pcDNA3.1B and SGC7901were evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay. Asshown in Table 1, in the absence of LY294002 or AktsiRNA, the control and parental cells showed highersensitivity to ADR and VCR than adding LY294002or Akt siRNA. However, the inhibitory rate in cellstransfected with PrPCwas significantly different to thatin control cells (P < 0.05). When the cells were treatedwith a high dose of the inhibitor LY294002 (40 lm)orco-transfected with Akt siRNA (1 lg) for 24 h, therelative inhibitory rate in SGC7901/PrPCwasdecreased to levels similar to the controls because oftheir toxicity in cell death (P > 0.05).The effects of LY294002 on adriamycin accumula-tion and retention in SGC7901/PrPCcells were furtherdetermined by flow cytometric analysis. The adria-mycin-releasing index in gastric cancer SGC7901 cellswas calculated as follows: releasing index = (accumu-lation value ) retention value)/accumulation value.The results showed less adriamycin accumulation andretention in SGC7901/PrPCcells compared with thatin controls. When the cells were treated withLY294002 or co-transfected with Akt siRNA for 24 h,the accumulation and retention of adriamycinincreased in both cell lines, but was more significant inSGC7901/PrPC(P < 0.05). The above results indi-cated a partly dose-dependent effect, but the effectmore significant at concentrations of 10 lm LY294002or 0.2 lg Akt siRNA. The releasing index alsodecreased more sharply at 10 lm LY294002 or 0.2 lgAkt siRNA in SGC7901/PrPC. The highest concentra-tions of LY294002 (40 lm) or Akt siRNA (1 lg)resulted in similar releasing rates to each other becauseof their toxicity effect (P > 0.05) (Fig. 3). The resultsindicated that inhibition of the PI3K/Akt signalingpathway leads to inhibition of PrPC-induced cell drugresistance in gastric cancer cells.PI3K/Akt is involved in the activation of P-gp byPrPCin gastric cancerTo further investigate the underlying mechanism ofPI3K/Akt-mediated PrPC-induced gastric cancer MDR,the PrPC-overexpressing cell lines (SGC7901/PrPC) andcorresponding controls (SGC7901/pcDNA) were trea-ted with LY294002 or Akt siRNA to screen the down-stream molecules. PrPC-transfected gastric cancer cellswere treated with LY294002 (10 lm) or Akt siRNA(0.2 lg), and exhibited downregulation of P-gp at boththe mRNA and protein levels (Fig. 4A). Inhibition ofthe PI3K/Akt pathway decreased the expression of P-gpinduced by PrPCat both the mRNA and protein levels,suggesting transcriptional regulation of P-gp by PI3K/Akt in PrPC-transfected gastric cancer cells. Therefore,the promoter sequence of MDR-1 ()136 to 10) wasamplified, and the luciferase reporter assay wasperformed to investigate the transcriptional regulationof P-gp by PI3K/Akt. The luciferase activity of P-gpAB(a) (b)(a) (b)(c) (d)(c)Fig. 1. Co-expression of PrPCand Akt ingastric cancer. (A) Serial sections of gastriccancer tissue were stained with antibodiesagainst PrPC(3F4, Sigma) or p-Akt (Thr 308;Cell Signaling Technology). (a) Gastric can-cer tissue stained with anti-p-Akt (Thr 308).(b) Gastric cancer tissue stained with anti-PrPC. (c) Negative control (original magnifica-tion, ·200). (B) Co-expression of PrPCwithp-Akt in SGC7901/ADR cells. (a) Confocalmicroscopic imaging of p-Akt, stained withmonoclonal antibody against p-Akt and FITC-conjugated goat anti-mouse IgG (green). (b)Confocal microscopic imaging of PrPC,stained with polyclonal antibody against PrP(Santa Cruz Biotechnology) and tetraethylrhodamine isothiocyanate-labeled rabbit anti-goat IgG (red). (c) Co-expression of p-Aktwith PrPCresults in yellow staining. (d)Co-expression of p-Akt with PrPC, withnuclear staining by 4¢,6-diamidino-2-phenylin-dole (DAPI) (blue) (original magnification,·400).J. Liang et al. PI3K/Akt in PrPC-induced MDRFEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 687promoter in gastric cancer cells decreased with or with-out PrPCtransfection by adding LY294002 orco-transfection with Akt siRNA. However, SGC7901transfected with PrPCshowed significantly decreasedP-gp promoter activity compared with the control cells(SGC7901/pcDNA and SGC7901 cells) after additionof LY294002 or co-transfection with Akt siRNA(Fig. 4B). PI3K/Akt might therefore be involved intranscriptional activation of P-gp in gastric cancer cellstransfected with PrPC. Inhibition of the PI3K/Akt path-way by its specific inhibitor or Akt siRNA could reversethe PrPC-induced MDR effect, partly through decreas-ing transcriptional activation of P-gp.DiscussionIn the present study, we present the first evidence thatPI3K/Akt may be involved in the transcriptional acti-vation of P-gp in gastric cancer cells transfected withPrPC. Inhibition of the PI3K/Akt pathway by its spe-cific inhibitor or Akt siRNA reverses PrPC-inducedMDR in gastric cancer cells, partly by decreasing thetranscriptional activation of P-gp. Continuing fromour previous work, it further reveals the function ofPrPCin the MDR of cancers.Over recent years, many investigations have focusedon the physiological and pathological processes ofPrPC[3]. Recently, PrPChas been reported to play apositive role in MDR of many types of human cancers[15]. Levenson et al. [16] analyzed cell lines in whichMDR had been induced by genetic suppressor ele-ments of cDNA array hybridization, and found thatthe transcription level of PrPCwas increased. Our pre-vious studies had shown that PrPCis ubiquitouslyexpressed in gastric carcinoma cell lines and tissues butis weakly or not expressed in normal gastric mucosa[6,7,9,13]. In vitro and in vivo drug sensitivity assaysindicated that PrPCcould promote the drug resistanceof a gastric cancer cell line [5]. However, little isknown about the molecular mechanism involved inthis process.ABFig. 2. The inducible effect of PrPCon Akt. (A) Western blot analy-sis of the cells transfected with the empty vector or with PrPC.b-actin was used as a loading control. (B) Expression of p-Akt andtotal Akt were determined in gastric cancer cells by Western blot.b-actin was used as an internal control. Autoradiograms werequantified by densitometry and p-Akt protein levels were calculatedrelative to the amount of b-actin protein.Table 1. IC50values (lgÆmL)1) for anticancer drugs for gastric cancer cells. Survival rates of gastric cancer cells treated with anticancerdrugs were evaluated by the MTT assay as described in Experimental procedures. Dose–effect curves for the anticancer drugs were plottedon semi-logarithmic coordinate paper, and IC50values were determined. Data are means ± SD of three independent experiments.Cell linesLY294002 (lM) Akt siRNA (lg)0 10 20 40 0 0.2 0.4 1AdriamycinSGC7901/PrPC6.87 ± 0.79 4.12 ± 0.64 2.58 ± 0.34 0.84 ± 0.17 6.87 ± 0.79 4.92 ± 0.74 3.76 ± 0.49 1.39 ± 0.25SGC7901/pcDNA3.1B 0.43 ± 0.03 0.37 ± 0.05 0.28 ± 0.02 0.20 ± 0.03 0.43 ± 0.03 0.38 ± 0.06 0.30 ± 0.03 0.24 ± 0.04SGC7901 0.31 ± 0.03 0.29 ± 0.04 0.25 ± 0.03 0.19 ± 0.02 0.31 ± 0.03 0.32 ± 0.05 0.26 ± 0.02 0.22 ± 0.04VincristineSGC7901/PrPC7.38 ± 0.78 5.21 ± 0.56 2.69 ± 0.38 0.34 ± 0.21 7.38 ± 0.78 5.83 ± 0.59 3.16 ± 0.43 0.83 ± 0.35SGC7901/pcDNA3.1B 0.24 ± 0.02 0.20 ± 0.03 0.17 ± 0.02 0.09 ± 0.01 0.24 ± 0.02 0.22 ± 0.06 0.18 ± 0.04 0.12 ± 0.03SGC7901 0.14 ± 0.02 0.12 ± 0.04 0.10 ± 0.03 0.08 ± 0.02 0.14 ± 0.02 0.13 ± 0.05 0.11 ± 0.04 0.09 ± 0.02PI3K/Akt in PrPC-induced MDR J. Liang et al.688 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBSP > 0.05P < 0.05P < 0.05P > 0.050.450.40.350.30.250.20.150.10.050Releasing indexP > 0.05P < 0.05P < 0.05P > 0.05SGC7901/PrPSGC7901/pcDNA252030AB15105Fluorescence intensity00 µM 10 µM 20 µMLY29400240 µM0 µg 0.2 µg 0.4 µgsiRNA of Akt1 µg 0 µg 0.2 µg 0.4 µgsiRNA of Akt1 µg0 µM 10 µM 20 µMLY29400240 µM252015105Fluorescence intensity0P < 0.05P < 0.05P > 0.05P > 0.050.450.40.350.30.250.20.150.10.050Releasing indexP > 0.05P > 0.05P < 0.05P < 0.05SGC7901/PrPSGC7901/pcDNASGC7901/PrPSGC7901/pcDNASGC7901/PrPSGC7901/pcDNAFig. 3. Fluorescence intensity and releasing index of adriamycin in gastric cancer cells. Gastric cancer cells were treated with or withoutLY294002 (10, 20 or 40 lM) or co-transfected with Akt siRNA (0.2, 0.4 or 1 lg) for 24 h. Adriamycin was added to cells in log phase to afinal concentration of 5 lgÆmL)1. After 1 h, cells were harvested (for detection of adriamycin accumulation) or cultured in drug-free RPMI-1640 for another 30 min, followed by harvesting (for detection of adriamycin retention). The fluorescence intensity of intracellular adriamycinwas determined using flow cytometry with an excitation wavelength of 488 nm and an emission wavelength of 575 nm. (A) Fluorescenceintensity analysis of intracellular adriamycin in gastric cancer cells. (B) Adriamycin releasing index of gastric cancer cells. The releasingindex = (accumulation value ) retention value)/accumulation value.ABFig. 4. PI3K/Akt is involved in the activation of P-gp by PrPCin gastric cancer. (A) Expression of P-gp at both the mRNA and protein levelswas investigated in PrPC-transfected gastric cancer cells treated with LY294002 (10 lM) or Akt siRNA (0.2 lg). b-actin was used as a loadingcontrol. Autoradiograms were quantified by densitometry, and gene or protein levels were calculated relative to the amount of b-actin geneor protein. (B) Luciferase reporter assay to determine the regulatory effect of PI3K/Akt on MDR-1 promoter activity in PrPC-transfected cells.A dual luciferase system was used in this assay. The promoter activity was measured in terms of relative luminescence units (RLU),calculated using the following formula: RLU = luminescence intensity of the Firefy luciferase/luminescence intensity of the Renilla luciferase.Control, cells co-transfected with empty pcDNA3.1 vector or parental cells SGC7901, pGL-MDR vector and pRL-TK vector; PrPC, cellsco-transfected with empty pcDNA3.1B/PrPCvector treated with or without LY294002 (10 lM) or Akt siRNA (0.2 lg), pGL-MDR vector andpRL-TK vector. The luciferase activities of each reporter plasmid were measured in triplicate and are expressed as fold inductions afternormalization.J. Liang et al. PI3K/Akt in PrPC-induced MDRFEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 689Multidrug resistance (MDR) is one of the majorcauses of failure of chemotherapy of human malignan-cies. Studies have shown that cellular drug resistance ismediated by various mechanisms operating at varioussteps in the cytotoxic activity of the drug, from adecrease of drug accumulation in the cell to abrogationof apoptosis induced by the chemical substance. Oftenseveral different mechanisms were switched on in thecells, but usually one major mechanism was operating.MDR-1 (ABCB1, P-glycoprotein) is known to signifi-cantly alter the extent of drug absorption and excre-tion, which play a key role in the MDR of cancers[17]. Previous studies identified P-gp as an importantmolecule in gastric cancer [4–6,18–20] and leukemiaMDR [20].PI3K/Akt signal transduction pathway has beenreported to be involved in the neuroprotective effect ofhumanin on cerebral ischemia/reperfusion injury [21].Activation of the PI3K/Akt pathway is one of thecritical steps in cell survival and MDR [22]. Thepresent study focuses on whether the PI3K/Akt path-way contributes to the PrPC-induced MDR phenotypein gastric cancer cells. We show that PrPCand Aktare co-expressed in gastric carcinoma, and whoseexpression was related to MDR in gastric cancer.PrPC-transfected cell lines showed increased expressionof phosphorylated Akt, indicating that PrP may serveas a positive upstream regulator of PI3K/Akt in gastriccancer cells. By inhibiting the PI3K/Akt pathway usingLY294002 or co-transfection with Akt siRNA, thedrug sensitivity and accumulation in SGC7901/PrPCcells were significantly increased. The results indicatethat inhibition of the PI3K/Akt signaling pathwaymay lead to inhibition of the MDR induced by PrPCin gastric cancer cells.The mechanism underlying PI3K/Akt-mediatedPrPC-induced MDR in gastric cancer was further inves-tigated. PrPC-transfected gastric cancer cell lines andcorresponding controls were treated with LY294002 orAkt siRNA as described previously [6]. PrPC-transfectedcells treated with an inhibitor of Akt exhibited downre-gulation of P-gp at both the mRNA and protein levels;this was proven to be due to transcriptional inhibitionof MDR-1 using a luciferase reporter assay. Thus thePI3K/Akt pathway may be involved in transcriptionalactivation of P-gp in PrPC-transfected gastric cancercells, inhibition of which would reverse gastric cancerMDR, partly by decreasing the transcriptional activa-tion of P-gp. This model of a PrPC/PI3K/P-gp signalagrees with other reported findings on prion protein sig-naling. It was found that the Fyn protein governed anumber of the PrPC-induced pathways that convergedto the PI3K module in neurons [23]. PI3K is known tophysically associate with Fyn to transducing differen-tiation signals [24]. It has also been demonstrated thatconstitutively activated PI3K enhances activation ofthe MDR-1 promoter by 2-acetylaminofluorene [25].In the present study, we report for the first time thatactivation of PI3K/Akt signaling pathway plays anessential role in PrP-induced MDR in gastric cancercells. Inhibition of the PI3K/Akt signaling pathway byLY2940002 or Akt siRNA leads to inhibition of PrPC-induced cell drug resistance and P-gp upregulation ingastric cancer cells, which indicated a possible novelmechanism by which PrPCregulates gastric cancer cellsurvival.Experimental proceduresAntibodies and reagentsSP-9000 Histostain-Plus kits were obtained from Zhong-shan Goldbridge Biotechnology (Beijing, China). The drugsvincristine (VCR) and adriamycin (ADR) were purchasedfrom Farmitalia Carlo Erba (Milan, Italy) and MinshengPharmaceutical Company (Hangzhou, China), respectively.The antibodies rabbit anti-human t-Akt, mouse anti-humanp-Akt and mouse anti-human P-gp, and the PI3K/Akt-specific inhibitor LY294002 were obtained from Cell Signal-ing Technology (Beverly, MA, USA). Mouse anti-humanmonoclonal PrPCserum (3F4) was purchased from Sigma(St Louis, MO, USA) and rabbit anti-human polyclonalPrP was purchased from Santa Cruz Biotechnology (SantaCruz, CA, USA). The Sp1 immunohistochemistry kit andfluorescein isothiocyanate (FITC)-labeled goat anti-rabbitand goat anti-mouse IgG were purchased from ZhongshanGoldbridge Biotechnology (Beijing, China).Clinical samplesEighty-five gastric carcinoma patients (34 females, 51males; mean age 56.1 ± 11.5 years; range 29–78 years)were included from a population-based case-controlledstudy conducted in Xijing Hospital, Xi’an, China. Patientswhose surgical tissue was used for the study signedinformed consent. All cases of gastric cancer were clini-cally and pathologically proved. The protocols used in thestudy were approved by the hospital’s Protection ofHuman Subjects Committee. Formalin-fixed paraffin-embedded tissue sections were retrieved from archives atthe Department of Pathology. Demographic and clinico-pathological information was obtained from our popula-tion-based database, and tumor staging was carried outfor each case according to the classification at the time ofsurgery. Thirty cases were classified as well-differentiated,43 as moderately differentiated and 12 as poorly differen-tiated gastric cancers.PI3K/Akt in PrPC-induced MDR J. Liang et al.690 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBSImmunohistochemistry analysisTissue sections from gastric carcinoma were immunostainedusing SP-9000 Histostain-Plus kits. The slides were depa-raffinized, rehydrated, blocked and then primary antibodywas added as described previously [7]. Biotinylated goatanti-mouse IgG was applied to the cell sections, which werethen incubated at room temperature for 30 min. Afterwashing with NaCl/Pifor 10min, the tissues were incubatedwith avidin dehydrogenase/biotinylated peroxidase for30 min. Color was developed by immersion of the sectionsin a peroxidase substrate diaminobezidin solution.Evaluation of immunostainingAll sections were examined independently by two observerswith respect to the various histopathological characteristicsand specific immunoreactivity (IR). The staining was semi-quantitatively evaluated by assigning a score for the inten-sity of the IR and for the proportion of cells positivelystained. The intensity of IR (intensity score) was dividedinto four categories: 0, no IR; 1, weak IR (+); 2, moderateIR (++); 3, strong IR (+++). The proportion of posi-tive cells was classified into five groups: 0, no tumor cellsexhibiting IR; 1, < 25% of the tumor cells exhibiting IR;2, 25–50% of the tumor cells exhibiting IR; 3, 50–75% ofthe tumor cells exhibiting IR; 4, > 75% of the tumor cellsexhibiting IR. The overall score was the multiplication ofthe two. The scores were then classified as negative (score 0or 1) or positive (score ‡ 2).Cell cultureThe human gastric adenocarcinoma cell line SGC7901 wasobtained from Academy of Military Medical Science (Beij-ing, China). SGC7901/ADR was selected from SGC7901 byincreasing ADR stepwise from 0.01 to 0.8 lgÆmL)1, andhas been characterized previously [26]. The cells weremaintained in RPMI-1640 containing 10% heat-inactivatednewborn bovine serum (SiJiQing, Hangzhou. China) at37° C in a humidified atmosphere of 5% CO2and 95% air.Double immunofluorescence stainingDouble immunostaining for antigen co-localization was per-formed using FITC-conjugated goat anti-mouse IgG (Chem-icon, Billerica, MA, USA; 1 : 80) and tetraethylrhodamineisothiocyanate-labeled rabbit anti-goat IgG (Chemicon,1 : 100). Cells were nuclear-stained using 4¢,6-diamidino-2-phenylindole (DAPI). The primary antibody combinationsconsisted of monoclonal antibody against p-Akt and mono-clonal antibody against PrP. SGC7901/ADR cells were incu-bated on glass coverslips for 24 h and fixed with 4%paraformaldehyde in NaCl/Pi. The fixed cells were stainedand examined using a FLUOVIEW FV1000 laser scanningconfocal microscope (Olympus, Tokyo, Japan).Plasmid construction and transfectionThe target sequences were aligned to the human genomedatabase by a blast search to ensure that the chosensequences were not highly homologous to those of othergenes. The primers were designed using primer.5 software(Premier Co., Edmonton, Canada) or the siRNA targetfinder at https://www.genscript.com/ssl-bin/app/rnai, andare listed in Table 2. siRNAs for PrP, Akt and control werechemically synthesized (Invitrogen, Carlsbad, CA, USA) andthe target sequences were as previously reported [5–7,9,13,15]. SGC7901 cells were transfected with the plasmidsand maintained in medium supplied with 400 lgÆmL)1of theneomycin analogue G418 (Life Technologies Inc., Gaithers-burg, MD, USA). The expression levels of PrPCin G418-resistant clones were evaluated by Western blot analysis.RNA extraction and semi-quantitative RT-PCRTotal RNA was extracted from SGC7901/PrPCandSGC7901/pcDNA, and DNase was used to decrease theTable 2. Primers for plasmid construction.Gene Direction Sequence (5¢-to3¢)PrPCSense CCCAAGCTTGGGATGGCGAACCTTGGCTGCTAntisense CGGGATCCTCCCACATCAGGAAGATGAGGAPrPCRNAi1 Sense TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTTAntisense CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAAPrPCRNAi2 Sense TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTTAntisense CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCACAkt RNAi Sense TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTTAntisense CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTAMDR-1 Sense CTCGAGGAATCAGCATTCAGAntisense AGATCTCTTTGAGCTTGGAAGAGCMDR-1 promoter Sense CTCGAGGAATCAGCATTCAGAntisense AGATCTCTTTGAGCTTGGAAGAGCJ. Liang et al. PI3K/Akt in PrPC-induced MDRFEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 691contamination of genomic DNA. The PCR primers andreaction parameters used for MDR-1 amplification arelisted in Table 1. The reaction conditions for PCR ofMDR-1 were as follows: initial denaturation at 94° C for10 min, and 35 cycles of denaturation at 94° C for 30 s,annealing at 55° C for 30 s and extension at 72° C for 30 son a Touchgene gradient thermal cycler (Techne, Cam-bridge, UK). Appropriate numbers of cycles were chosen toensure completion of PCR amplification before reachingthe stable stage in each reaction. Gene expression wasquantified as the relative yield of the PCR product fromtarget sequences compared to that from the b-actin gene.PCR products were loaded onto a 1.5% agarose gel andseparated electrophoretically. The gel was then visualizedunder ultraviolet light following ethidium bromide staining.Autoradiograms were quantified by densitometry. RelativeRNA levels were calculated relative to the levels for theb-actin gene.Western blot analysisCells in log phase were harvested and washed twice for10 min with NaCl/Pi, then lyzed in lysis buffer (150 mmolÆL)1Tris/HCl pH 8.0, 50 mmolÆL)1NaCl, 0.2 mmolÆL)1EDTA, 0.1 mmolÆL)1phenylmethanesulfonyl fluoride and10 gÆL)1Nonidet P-40). Fifty micrograms of protein fromeach cell lysate were separated by 12% SDS–PAGE underdenaturing conditions, and transferred to nitrocellulosemembrane (Amersham, Pittsburgh, PA, USA). The mem-brane was blocked with 10% non-fat dry milk in NaCl/Tris-T (20 mm Tris/HCl, 100 mm NaCl, 0.1% Tween-20)for 2 h at room temperature, probed with the primary anti-bodies against Akt (1 : 1000), p-Akt (Thr308; 1 : 1000),P-gp (1 : 1000), and PrPC3F4 (1 : 1000) overnight at 4° Cand subsequently incubated with horseradish peroxidase-linked secondary antibodies in NaCl/Tris-T (with 5%non-fat dry milk). Bound antibodies were visualized bychemiluminescent substrate as described by the manufac-turer (Zhongshan Goldbridge Biotechnology). Autoradio-grams were quantified by densitometry. Protein levels werecalculated relative to the amount of b-actin protein.In vitro drug sensitivity assayThe P-gp-affecting drugs adriamycin (ADR) and vincristine(VCR) were both freshly prepared before each experiment.Drug sensitivity was evaluated using the 3-(4,5-dim-ethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT)assay. Cells in the log growth phase were diluted with200 lL RPMI-1640 supplemented with 100 mLÆL)1new-born bovine serum, and seeded into 96-well plates (Costar,New York, NY, USA) at a density of 8 · 103cells/well.After 24 h, the medium was replaced with fresh growthmedium containing various concentrations of drugs and 10,20 or 40 lm LY294002 or dimethylsulfoxide (solventcontrol). After 48 h growth in the presence of drugs, 20 lLMTT reagent (final concentration 5 gÆL)1) was added toeach well, the supernatant was discarded after 4 h, and150 lL dimethylsulfoxide was added to melt the crystals.The absorbance of the formazan product was measuredusing an ELISA reader (Bio-Rad, Hercules, CA, USA) at awavelength of 492 nm. The drug concentration that pro-duced 50% inhibition of growth (IC50) was estimated usingrelative survival curves. The survival rate was calculated asmean A490of treated wells/mean A490of untreatedwells · 100%, where A490indicates the absorbance of thesolution at 490 nm. Finally, dose–effect curves for the anti-cancer drugs were plotted on semi-logarithmic coordinatepaper and IC50values were determined. Each study wasperformed in triplicate and repeated three times.Flow cytometric analysisCells were cultured in six-well culture plates at 37° C for24 h, and ADR was added to a final concentration of5mgÆL)1. After further culture for 1 h, various concentra-tions of LY294002 (10, 20 or 40 lm) were added and themixtures were incubated for 1 h. Dimethylsulfoxide wasused for the negative control. Cells were harvested, or cul-tured in drug-free medium for another 30 min and thenharvested. The harvested cells were suspended in coldNaCl/Pi, and the intracellular adriamycin fluorescenceintensity was determined by flow cytometric analysis withexcitation and emission wavelengths of 488 and 575 nm,respectively.Luciferase reporter assayThe promoter sequence of MDR-1 ()136 to 10) was ampli-fied from the genomic DNA of peripheral blood mono-nuclear cells by PCR [27]. The primers used are shown inTable 1. The promoter sequences were then cloned into apGL3 enhancer vector (Promega, Madison, WI, USA) toconstruct the reporter vector pGL-MDR. SGC7901 cellswere passaged into 24-well plates at a density of5 · 105cells/well, and incubated until they reached 90%confluence. pcDNA3.1/PrPCor empty pcDNA3.1/V5-his Bplasmids were transfected into SGC7901 cells withpGL-MDR using Lipofectamine 2000 reagent (Invitrogen).pRL-TK was used as a control for transfection efficiency.Luciferase reporter assays were performed using the dual-luciferase reporter assay system (Promega) according to themanufacturer’s instructions. Each experiment was per-formed in triplicate and repeated three times.Statistical analysisEach experiment was repeated at least three times.Numerical data are presented as the means ± SD. Thesignificance of the difference between means was deter-PI3K/Akt in PrPC-induced MDR J. Liang et al.692 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBSmined using Student’s t test. The Wilcoxon signed-ranktest was used to evaluate the intensity of IR and the pro-portion of cells staining positively in the immunohisto-chemical assay. Correlation between two groups wasassessed by Spearman analysis. All statistical analyseswere performed using spss11.0 software (SPSS, Chicago,IL, USA). A P value < 0.05 was considered statisticallysignificant.AcknowledgementsThis study was supported in part by grants from theChinese National Foundation of National Sciences(30572134 and 30872965) and the National BasicRsearch Program of China (2009CB521703). We thankProfessor Jie Liu for the pSilencer vector plasmid usedfor siRNA construction. We are also grateful to BoHuang (Department of Biochemistry, Fourth MilitaryMedical University, Xi’an, Shaanxi, China) for helpwith the luciferase activity analyses, Dan Chen(Department of Microscope, Fourth Military MedicalUniversity, Xi’an, Shaanxi, China) for help with confo-cal microscope detection, and technicians TaidongQiao, Zhen Chen, Baojun Chen and Baohua Song fortheir excellent technical assistance.References1 Prusiner SB, Scott MR, Dearmond SJ & Cohen FE(1998) Prion protein biology. Cell 93, 337–348.2 Christensen HM & Harris DA (2008) Prion proteinlacks robust cytoprotective activity in cultured cells.Mol Neurodegeneration 3, 11.3 Aguzzi A & Polymenidow M (2004) Mammalian prionbiology. One century of evolving concepts. Cell 116,313–327.4 Zhao Y, You H, Liu F, An H, Shi Y & Fan D (2002)Differentially expressed gene profiles between multidrugresistant gastric adenocarcinoma cells and their parentalcells. Cancer Lett 185, 211–218.5 Du JP, Jin XH, Shi YQ, Zhao YQ, Liu CJ, Cao YX,Qiao TD, Chen BJ & Fan DM (2003) The overexpres-sion of prion protein in drug resistant gastric cancer cellline SGC7901/ADR and its significance. Zhonghua YiXue Za Zhi 83, 328–332.6 Du J, Pan Y, Shi Y, Guo C, Jin X, Sun L, Liu N, QiaoT & Fan D (2005) Overexpression and significance ofprion protein in gastric cancer and multidrug-resistantgastric carcinoma cell line SGC7901/ADR. Int J Cancer113, 213–220.7 Liang J, Pan YL, Ning XX, Sun LJ, Lan M, Hong L,Du JP, Liu N, Liu CJ, Qiao TD et al. (2006) Over-expression of PrPC and its antiapoptosis function ingastric cancer. Tumour Biol 27, 84–91.8 Liang J, Ge FL, Lu YY, Wang J, Zhai HH, Yao LP,Li TT, Ji Q, Guo XY, Liu ZX et al. (2006) Role ofPrPc related to apoptosis. Experimental and ClinicalSciences International Journal 5, 11–24.9 Pan Y, Zhao L, Liang J, Liu J, Shi Y, Liu N, ZhangG, Jin H, Gao J, Xie H et al. (2006) Cellular prion pro-tein promotes invasion and metastasis of gastric cancer.FASEB J 20, 1886–1888.10 Akiyama H, Furukawa S, Wakisaka S & Maeda T(2006) Cartducin stimulates mesenchymal chondropro-genitor cell proliferation through both extracellularsignal-regulated kinase and phosphatidylinositol3-kinase/Akt pathways. FEBS J 273, 2257–2263.11 Han Z, Hong L, Wu K, Han S, Shen H, Liu C, Han Y& Fan D (2006) Reversal of multidrug resistance of gas-tric cancer cells by downregulation of Akt1 with Akt1siRNA. J Exp Clin Cancer Res 25, 207–212.12 Schmalzbauer R, Eigenbrod S, Winoto-Morbach S,Xiang W, Schu¨tze S, Bertsch U & Kretzschmar HA(2008) Evidence for an association of prion protein andsphingolipid-mediated signaling. J Neurochem 106,1459–1470.13 Liang J, Zhang DX, Pan YL, Shi YQ, Guo CC, WangJB, Chen Y, Wang X, Liu J, Guo XG et al. (2007) Cel-lular prion protein promotes cell proliferation and G1/Stransition of gastric cancer cells SGC7901 and AGS.FASEB J 28, 173–180.14 Diarra-Mehrpour M, Arrabal S, Jalil A, Pinson X,Gaudin C, Pietu G, Pitaval A, Ripoche H, Eloit M,Dormont D et al. (2004) Prion protein prevents humanbreast carcinoma cell line from tumor necrosis factoralpha-induced cell death. Cancer Res 64, 719–727.15 Meslin F, Hamaı¨A, Gao P, Jalil A, Cahuzac N, Cho-uaib S & Mehrpour M (2007) Silencing of prion proteinsensitizes breast adriamycin-resistant carcinoma cells toTRAIL-mediated cell death. Cancer Res 67, 10910–10919.16 Levenson VV, Davidovich IA & Roninson IB (2000)Pleiotropic resistance to DNA-interactive drugs is asso-ciated with increased expression of genes involved inDNA replication, repair, and stress response. CancerRes 60, 5027–5030.17 Regev R, Katzir H, Yeheskely-Hayon D & Eytan GD(2007) Modulation of P-glycoprotein-mediated multidrugresistance by acceleration of passive drug permeationacross the plasma membrane. FEBS J 274, 6204–6214.18 Hao Z, Li X, Qiao T, Du R, Hong L & Fan D (2006)CIAPIN1 confers multidrug resistance by upregulatingthe expression of MDR-1 and MRP-1 in gastric cancercells. Cancer Biol Ther 5, 261–266.19 Du J, Shi Y, Pan Y, Jin X, Liu C, Liu N, Han Q, LuY, Qiao T & Fan D (2005) Regulation of multidrugresistance by ribosomal protein l6 in gastric cancer cells.Cancer Biol Ther 4, 242–247.J. Liang et al. PI3K/Akt in PrPC-induced MDRFEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 69320 Hong L, Piao Y, Han Y, Wang J, Zhang X, Du Y, CaoS, Qiao T, Chen Z & Fan D (2005) Zinc ribbon domain-containing 1 (ZNRD1) mediates multidrug resistance ofleukemia cells through regulation of P-glycoprotein andBcl-2. Mol Cancer Ther 4, 1936–1942.21 Xu X, Chua CC, Gao J, Chua KW, Wang H, HamdyRC & Chua BH (2008) Neuroprotective effect ofhumanin on cerebral ischemia/reperfusion injury ismediated by a PI3K/Akt pathway. Brain Res 1227,12–18.22 Fantappie`O, Solazzo M, Lasagna N, Platini F, Tessito-re L & Mazzanti R (2007) P-glycoprotein mediatescelecoxib-induced apoptosis in multiple drug-resistantcell lines. Cancer Res 67, 4915–4923.23 Santuccione A, Sytnyk V, Leshchyns’ka I & SchachnerM (2005) Prion protein recruits its neuronal receptorNCAM to lipid rafts to activate p59fyn and to enhanceneurite outgrowth. J Cell Biol 169, 341–354.24 Frossi B, Rivera J, Hirsch E & Pucillo C (2007) Selec-tive activation of Fyn/PI3K and p38 MAPK regulatesIL-4 production in BMMC under nontoxic stress condi-tion. J Immunol 178, 2549–2555.25 Kuo MT, Liu Z, Wei Y, Lin-Lee YC, Tatebe S, Mills GB& Unate H (2000) Induction of human MDR-1 geneexpression by 2-acetylaminofluorene is mediated by effec-tors of the phosphoinositide 3-kinase pathway that acti-vate NF-kappaB signaling. Oncogene 21, 1945–1954.26 An H, Zhou S & Fan D (1997) Establishmentand characteristics of an adriamycin resistant humangastric carcinoma cell line. J Dig Dis Endosc 2,108–113.27 Guo CC, Ding J, Yao LP, Sun L, Lin T, Song Y, SunLJ & Fan DM (2005) Tumor suppressor gene Runx3sensitizes gastric cancer cells to chemotherapeutic drugsby downregulating Bcl-2, MDR-1 and MRP-1. Int JCancer 116, 155–160.PI3K/Akt in PrPC-induced MDR J. Liang et al.694 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS . Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells Jie Liang*, Fulin Ge*, Changcun. cell drug resistance in gastric cancer cells. PI3K/Akt is involved in the activation of P-gp byPrPC in gastric cancer To further investigate the underlying
- Xem thêm -

Xem thêm: Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf, Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf, Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf