towards a new balance between negative and positive integration of european welfare states
taking shape - a new contract between architecture and nature
... biosphere – and that which is inside us – ‘human nature’ We refer to the Grand Canyon and to Hyde Park as nature We say certain acts are not ‘natural’, and speak authoritatively about what ‘nature ... (Plate 6): In the garden we are in the space of nature and culture, form and matter, concrete and abstract, exterior and interior And, significantly, we are in a space of the feminine and the masculine ... TAKING SHAPE For my parents and my students TAKING SHAPE A new contract between architecture and nature Susannah Hagan Architectural Press OXFORD AUCKLAND BOSTON JOHANNESBURG MELBOURNE NEW...
- 236
- 485
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language typology and ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make...
- 44
- 1,746
- 7
Five Year Strategic Plan (2011-2016) - Towards a New Dawn Ministry of Women and Child Development Government of India potx
... 223 ABBREVIATIONS ANM Auxiliary Nurse Midwife ASHA Accredited Social Health Activist AWCs Anganwadi Centres AWW Anganwadi Worker AWH Anganwadi Helper BDO Block Development Officer CARA Central Adoption ... of the Government, namely, National Rural Health Mission (NRHM), Sarva Shiksha Abhiyan (SSA), Total Sanitation Campaign (TSC) and Mahatma Gandhi National Rural Employment Guarantee Scheme (MGNREGS) ... Shortage of staff and office space groups acting as watchdogs and advocating for rights of women and children Lack of induction, orientation and refresher training for staff Web based portal containing...
- 223
- 354
- 0
A Novel Combination of Negative and Positive Selection in Artificial Immune Systems
... data instance matches any detector, it is claimed as non-self or anomaly Begin Begin Generate Random Candidates Input new samples Yes Match self samples? Match any detector? No No Accept as new ... (Figure 2 .a) , the detector candidates are generated by some random processes and matched against the given self sample set S The candidates that not match any element in S are eliminated and the ... this paper, we assume binary representation for all detectors and data Binary representation is the most simple and popular representation for detectors and data in AIS, and other representations...
- 10
- 353
- 0
CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING
... recall of each story you use a card filing system For each story you have one card for the title and author, and a card for every paragraph On each of these paragraph cards you enter a main and ... the list and forgotten while a new idea is searched for This means that all the multi-ordinate and associative possibilities of each word are cut off and boxed away while the mind wanders around ... ideas from Kusa-Hibari main secondary paragraph paragraph paragraph paragraph paragraph Below you will find sample key words and phrases from the notes of students who have previously done this...
- 52
- 671
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... guidelines approved by the Institutional Animal Care and Use Committee of the University of Tokyo MAPK p-Akt Akt BECs LECs Fig Isolation and characterization of mesenteric BECs and LECs expressing tsA58T...
- 11
- 873
- 0
Tài liệu Film Cool: Towards a New Film Aesthetic ppt
... century realist novel and drama Griffith’s Birth of a Nation and Intolerance are essentially social historical dramas that find an ancestor in American realism and naturalism of the late nineteenth ... relegates an examination of popular cinema as far from a conventional aesthetic approach to art as it possibly can The Silence of the Lambs is less an aesthetic work than a system of For an analysis ... melodrama, particularly in the early exchanges between Cynthia (Brenda Blethyn) and Hortense (Marianne Jean-Baptiste), and camera angles to ground the image in the parameters of an external social...
- 221
- 427
- 0
Partnering: A New Approach to Sexual and Reproductive Health doc
... prenatal care, safe delivery and postnatal care, especially breastfeeding and infant and women’s health care; prevention and appropriate treatment of infertility; abortion as specified in paragraph ... Model of Masculinity and New Paradigms of Fatherhood 119 Old Paradigm: Masculinity New Paradigm: Fatherhood Primary and sole financial provider Authoritarian disciplinarian Shares financial-provider ... programme constituencies, that is, practitioners, researchers, regional advisory teams, planners and managers, advocates, government officials and international and national NGOs, that are interested...
- 196
- 505
- 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... CAF-1 and acetylated histones H3/H4 Cell 87, 95–104 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M, Stillman B & Araki T (2001) FASCIATA genes for chromatin assembly factor-1 in Arabidopsis maintain ... Molecular cloning of CcCac1L and its interaction with CcLim15 (A) Schematic diagram of the CAF-1 large subunits in human, C cinerea and S cerevisiae The KER and ED domains are represented by black and...
- 10
- 487
- 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAATGCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site ... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAATGCGGCCGCTCAGTCCTGCTCCTCGGCCAC-3¢, ... 165-bp fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGCTACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢...
- 11
- 668
- 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx
... past and future), mood (indicative and imperative), and voice (active and passive) As concerns notation, usually several kinds of information are collapsed in a single abbreviation, cf K standing ... project of man-machine communication called TIBAQ (Text -and- Inference Based Answering of Questions, cf (Haji~ov@ and Sgall, 1981)) with no pre-arranged data base and with the capacity of self-enriching ... (which is an adjectival word-ending, ambiguous among nominative and accusative singular masculine-inanimate, and nominative singular masculine-animate, thus representing the adjectival "normal form,'),...
- 8
- 414
- 0
Space Command Sustainment Review - Improving the Balance Between Current and Future Capabilities pdf
... sustainment Analytic Approach and the Strategies-to-Tasks Framework 11 Figure 2.1 Areas of Analysis and Specific Focus Areas HQ AFSPC, SMC, wing inputs by area of analysis RAND evaluation and additions ... maintenance career field 33S communications maintenance career field ACC Air Combat Command ACC /A3 A Air Combat Command, Directorate of Air and Space Operations, Airspace, Ranges, and Airfield Operations ... ACC /A3 T Air Combat Command, Directorate of Air and Space Operations, Training Division ACC /A6 O Air Combat Command, Communications Directorate, Communications Division ACC /A7 V Air Combat Command,...
- 168
- 439
- 0
Báo cáo khoa học: "All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision" pptx
... adding just 30% of the target data to the source data achieved the same performance as that obtained by taking the entire source and target data Agirre and de Lacalle (2009) reported a 22% error ... sample datasets, viz., DSO corpus (Ng and Lee, 1996), MEDLINE corpus (Weeber et al., 2001) and the corpus made available by Koeling et al (2005) Each of these datasets contains a handful of target ... Tourism and Health The data for Tourism domain was downloaded from Indian Tourism websites whereas the data for Health domain was obtained from two doctors This data was manually sense annotated...
- 10
- 337
- 1
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx
... importance in regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and then industrially, different additives ... Tuula, Susanna, Katri, and Juha as an integral part of my intellectual welfare I have had the privilege to be able to attend several international conferences, to meet new colleagues, and to see ... mechanical behaviour of the fibre bonding domain Thus far the experimental data had indicated that plasticization by water was essential in regard to tensile properties of polysaccharide materials...
- 89
- 701
- 1
Choosing a New Organization for Management and Disposition of Commercial and Defense High-Level Radioactive Materials ppt
... to an annual appropriation, and Amtrak (a GOVCORP) has both dedicated funding streams and annual appropriations NASA (an IGA) receives annual appropriations In the case of annual appropriations, ... Civilian Radioactive Waste Management OLMS Office of Labor-Management Standards OMB Office of Management and Budget OPIC Overseas Private Investment Corporation OSHA Occupational Safety and Health ... House and Senate committee review of House and Senate strategic plans and annual committees review annual management and financial reports on operations and reports approve annual budgets Some GAO...
- 132
- 357
- 0
Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf
... from Mandarin than other regions in Mainland China One can easily spot Cantonese dialect articles in Hong Kong newspapers which are totally unintelligible to Mandarin speakers, while Mandarin articles ... Design and Implementation A rudimentary design of a Cantonese-Mandarin dialect MT system has been made, as shown in Figure The system takes Cantonese Pinyin sentences as input and generates Mandarin ... J., Tomita M and Goodman K (1992) Machine Translation: A Knowledge-Based Approach Morgan Kaufmann Publishers, San Mateo, California, USA Sinclair J (1991) Corpus, Concordance and Collocation Collins,...
- 5
- 438
- 0
WORLD INVESTMENT REPORT 2012 Towards a New GeNeraTioN of iNvesTmeNT Policies potx
... Bahrain, Liberia and Seychelles in Africa; and the Cook Islands, Maldives, the Marshall Islands, Nauru, Niue, Samoa, Tonga and Vanuatu in Asia; as well as economies in the Caribbean such as Anguilla, ... Anguilla, Antigua and Barbuda, Aruba, Barbados, Belize, the British Virgin Islands, the Cayman Islands, Dominica, Grenada, Montserrat, the Netherlands Antilles, Panama, Saint Kitts and Nevis, Saint ... economies of the Association of South-East Asian Nations (ASEAN) – Brunei Darussalam, Indonesia, Malaysia and Singapore – saw a considerable rise FDI flows to China also reached a record level of $124...
- 239
- 483
- 0
Math Concept Reader MCR g4 a new angle on trains and train stations
... drawing: an acute angle, an obtuse angle, and a right angle Label each angle Draw your own train map Include at least two sets of rails Label each set of rails as parallel or perpendicular Explain ... DIGITAL FINAL PROOF ca62xs_lay_061207ad_am.indd 1/9/07 9:09:15 AM DIGITAL FINAL PROOF Math Concept Reader A New Angle on Trains and Train Stations by Sarah Mastrianni Copyright © Gareth Stevens, ... tracks at the same time without crossing paths The metal rails that run along the inside of a track are always parallel The rails must stay the exact same distance apart even if the track curves around...
- 19
- 433
- 0
báo cáo hóa học:" Research Article Strong Convergence of a New Iterative Method for Infinite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert Spaces" pptx
... spaces,” Journal of Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 Y Yao, A general iterative method for a finite family of nonexpansive mappings,” Nonlinear Analysis: Theory, ... nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol 298, no 1, pp 279–291, 2004 G Marino and H.-K Xu, A general iterative method for nonexpansive mappings in Hilbert spaces,” ... Mathematical and Computer Modelling, vol 32, no 11–13, pp 1463–1471, 2000 26 S Atsushiba and W Takahashi, “Strong convergence theorems for a finite family of nonexpansive mappings and applications,”...
- 24
- 398
- 0
- towards a new type of analyse
- towards a unified approach to memory and statisticalbased machine translation
- teaching culture in the language classroom towards a new philosophy
- think of a number trick between 1 and 100
- think of a number trick between 1 and 10
- think of a number trick between 1 and 1000
- • a new tax system goods and services tax act 1999
- 3—balance between treatment and comparison villages at baseline
- seeking a balance between status and contract
- towards a new public management
- disaster rehabilitation towards a new perspective
- lakes limnology and limnetic ecology towards a new synthesis
- achieving a balance between efficacy and tolerability for a successful chronic therapy
- a balance between prooxidants and antioxidants
- architectural metrics for e commerce a balance between rigor and relevance
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25