0

thus the thesis lacks the feedback from test users and teachers to make a complete judgement on the used test

Báo cáo hóa học:

Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx

Hóa học - Dầu khí

... H3N2 HA and NA proteins since 1999 and (B) amino acid distances of H3N2 HA and NA (A) Seasonal amino acid next (A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and (B) amino ... season and none have been sampled since in Denmark Variations in the haemagglutinins Variation among H3N2 viruses The amino acid positions in H3N2 HA that have become fixed after 1999–2000 are ... sequences from Europe are made public Methods Human samples A total of 234 Danish human nasal swab suspensions or nasopharyngeal aspirates positive for influenza A, from 1999 to 2006, were available at...
  • 19
  • 579
  • 0
Tài liệu The Five Most Dangerous Issues Facing Sales Directors Today, and How to Guarantee a Permanent Improvement in Sales Results pdf

Tài liệu The Five Most Dangerous Issues Facing Sales Directors Today, and How to Guarantee a Permanent Improvement in Sales Results pdf

Tiếp thị - Bán hàng

... able to measure the value of each activity undertaken during the day and can make the connection to the overarching goals of the organization If there is no clear line of sight between what they ... give their managers are easy to use, are designed to appeal to and engage salespeople regardless of experience level, and, above all, can be used in manageable pieces so that sales teams can absorb ... "Maximizing a workforce around one common goal that creates value for the customer, the organization, and the employee is the only way to focus the activities of a sales team It is critical that each...
  • 29
  • 699
  • 1
Tài liệu Laser-Optimized Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Investment doc

Tài liệu Laser-Optimized Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Investment doc

Phần cứng

... copper, fiber optic cabling and connectivity is a significant part of the data center Fiber backbone links are also the most critical links because they carry data to and from a large number of sources, ... standards bodies • Enables easy migration to Gigabit and 10 Gigabit network speeds • Ideal for use in any LAN or data center fiber connection • Available in several products, grades, and ... can affect the angle and speed that a light pulse can travel This effect is the refractive index profile of the material, which is calculated as the ratio of the speed of light in a vacuum to...
  • 4
  • 460
  • 0
The road to reality   a complete guide to the laws of the universe    penrose, roger

The road to reality a complete guide to the laws of the universe penrose, roger

Vật lý

... mystical and occult connotations, such as with the supposed magical powers of pentagrams and heptagrams And there was an entirely suppositional attempted association between Platonic solids and the ... stars was seen to be closely associated with the change and relentless regularity of the seasons, and with the attendant clear-cut inXuence on the weather, and consequently on vegetation and animal ... that there are two other fundamental absolute ideals, namely that of the Beautiful and of the Good I am not at all averse to admitting to the existence of such ideals, and to allowing the Platonic...
  • 1,123
  • 542
  • 4
How to Make a Million – The Old-Fashioned WayBrandon Pipkin Author ppt

How to Make a Million – The Old-Fashioned WayBrandon Pipkin Author ppt

Quản trị kinh doanh

... he always had a goal to it and worked backward to get there He got into it because he learned what real estate agents made, was tired of farming and dairying, and thought real estate was a good ... decisions Even those that had a vision, with the exception of one, said it wasn’t concrete and that they had to be flexible and take life as it came Each millionaire was open to opportunities and ... than one way to skin a cat There was no right way or wrong way for these millionaires There was just the way they did it Unconsciously, they understood that they were in the best position to make...
  • 14
  • 401
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Budding viral hijackers co-opt the endocytic machinery to make a getaway" pps

Báo cáo khoa học

... domain and the other, the ‘prey’, as a fusion to a transcriptional activation domain The binding of the two proteins of interest, if it happens, links the DNA-binding domain to the activation domain, ... two-hybrid assay is a method for detecting an interaction between any two proteins The two candidates are each expressed in yeast as protein fusions: one, the ‘bait’, as a fusion to a DNA-binding domain ... during the production and budding of virus particles, Wang et al [1] used a yeast twohybrid assay of a mouse T-lymphoma cDNA library using Gag as bait and identified endophilin as a Gagbinding partner...
  • 5
  • 274
  • 0
Financial planning – the use of quantitative indicators to make a business decisions

Financial planning – the use of quantitative indicators to make a business decisions

Tài liệu khác

... in a manufacturing plant, a whole new factory, etc • Used in both public and private sector http://www.bized.ac.uk Investment Appraisal • methods of investment appraisal: – Payback Period – Accounting ... factor is looked up in a table • £329.77 is what you would have to invest today at a rate of interest of 4.25% to earn £500 in 10 years time The discount factor can be found through valuation ... http://www.bized.ac.uk Investment Appraisal A fork lift may be an important item but what does it contribute to overall sales? How long and how much work would it have to to repay its initial cost? Copyright:...
  • 29
  • 229
  • 0
AN1476   combining the CLC and NCO to implement a high resolution PWM

AN1476 combining the CLC and NCO to implement a high resolution PWM

Cao đẳng - Đại học

... fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality system processes and procedures are for its PIC® MCUs and ... 317-773-8323 Fax: 317-773-5453 Los Angeles Mission Viejo, CA Tel: 949-462-9523 Fax: 949-462-9608 Santa Clara Santa Clara, CA Tel: 408-961-6444 Fax: 408-961-6445 Toronto Mississauga, Ontario, Canada Tel: ... work, you may have a right to sue for relief under that Act Information contained in this publication regarding device applications and the like is provided only for your convenience and may be superseded...
  • 10
  • 230
  • 0
Providing Effective Financial Aid Assistance to Students from Foster Care and Unaccompanied Homeless Youth: A Key to Higher Education Access and Success pdf

Providing Effective Financial Aid Assistance to Students from Foster Care and Unaccompanied Homeless Youth: A Key to Higher Education Access and Success pdf

Tài chính doanh nghiệp

... went to court to set up a guardianship so Donna could stay with her grandmother and the grandmother could make health and education decisions for Donna while the mother was living abroad Donna’s ... instructions from the US Department of Education (ED), FAFSA, NASFAA, the Application and Verification Guide of the FSA Handbook, and HUD The case examples used in the reference tools are also provided ... years Donna’s mother went to court to set up a guardianship so Donna could stay with her grandmother and the grandmother could make health and education decisions for Donna while the mother was living...
  • 40
  • 355
  • 0
Methylation - From DNA, RNA and Histones to Diseases and Treatment by Anica Dricu ppt

Methylation - From DNA, RNA and Histones to Diseases and Treatment by Anica Dricu ppt

Sức khỏe giới tính

... (Cytosine-5)-DNA Methyltransferases: Structural and Functional Characterization A Yu Ryazanova, L A Abrosimova, T S Oretskaya and E A Kubareva Additional information is available at the end of the ... orientation Therefore, the nucleophilic attack onto the cytosine C6 atom can be 35 36 Methylation - From DNA, RNA and Histones to Diseases and Treatment From DNA, RNA and Histones to Diseases and Treatment ... DNA, RNA and Histones to Diseases and Treatment From DNA, RNA and Histones to Diseases and Treatment cible genes and interacting with transcription initiation factors They can be activated either...
  • 310
  • 344
  • 1
study the substitution of fossil fuels by rdf produced from municipal solid waste of hanoi  m.a thesis  waste management and contaminated site treatment

study the substitution of fossil fuels by rdf produced from municipal solid waste of hanoi m.a thesis waste management and contaminated site treatment

Khoa học tự nhiên

... out to mix with air and then put back into the barrel At the same time, waste sample was taken to measure water content Waste had been kept in the barrel until water content o f w'aste was stable ... and more intense industrialization These activities increase the proportion o f nondegradable waste (such as plastic, metal, and glass) found in urban waste Plastics, metal, glass increased from ... Evaporation Exhaust air Biological drying I Mixed Stabilaf | approx 70* Fractionation Metal separation Density separation^» Light material approx b0% Calorific value KU/t O f / U p Stabilat*...
  • 51
  • 469
  • 0
Báo cáo y học:

Báo cáo y học: "Does switching from oral extended-release methylphenidate to the methylphenidate transdermal system affect health-related quality-of-life and medication satisfaction for children with attention-deficit/hyperactivity disorder&

Y học thưởng thức

... appetite and insomnia, the majority of caregivers agreed that the medication caused their child to want to eat less, and approximately one-third of caregivers agreed that the medication made it hard ... phone call to caregivers at 30 ± days after the last dose of study medication to assess any new or ongoing AEs Health-related quality of life and medication satisfaction measures As secondary ... using the AIM-C, a validated caregiver-completed measure As noted earlier, the AIM-C consists of a 10-item scale to assess the impact of ADHD on the caregiver and life at home In addition, the caregiver...
  • 12
  • 757
  • 0
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan

Môi trường

... in detail and material balances around reservoirs were considered RESEARCH PROCEDURE Location: Matsuyama region and periphery of the Seto Inland Sea The location of the research area and the distribution ... reactions REFERENCES American Public Health Association (APHA)/American Water Works Association (AWWA)/Water Environment Federation (WEF) (1998) Standard Methods for the Examination of Water and Wastewater, ... - Relationship between nitrate concentration and its removal rate by algae Fig - Relationship between nitrate concentration and denitrification rate On the other hand, denitrification rate, which...
  • 10
  • 717
  • 0
Tài liệu The Investing Secrets of Warren Buffett—and how to profit from them pptx

Tài liệu The Investing Secrets of Warren Buffett—and how to profit from them pptx

Quản lý dự án

... the USA and ARB and Harvey Norman in Australia.2 Discover some of the common sense tests for determining the financial health of thousands of listed companies in Australia, Canada and the USA Future ... think is that as soon as I have made a new discovery, I want to two things Firstly, I want to find all its practical consequences Secondly, as an educator I want to make it available to the widest ... personally taught generations of investors, analysts and fund managers how to analyze and manage investments I have also developed large scale trading systems for Bankers Trust Funds Management and...
  • 27
  • 618
  • 1
Tài liệu Banks’ exposure to interest rate risk, their earnings from term transformation, and the dynamics of the term structure pptx

Tài liệu Banks’ exposure to interest rate risk, their earnings from term transformation, and the dynamics of the term structure pptx

Ngân hàng - Tín dụng

... disentangle the contributions of the systematic factor and of the regulation One can expect some correlation between the regulatory variables outi (t) and out2i (t) on the one hand, and the variables ... that the belonging to certain banking groups, the banks’ size, their earnings and balance composition, and the banks’ application of derivatives have a significant impact on their exposure to ... systematic factor and the regulation to the total timely variation of the exposure is 17.24% and, therefore, 82.76% of the variation is due to idiosyncratic effects These effects may be changes in the...
  • 40
  • 551
  • 1
Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx

Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx

Báo cáo khoa học

... GCCGCCACCATGCAATCAGACATTGCGCAAGGAAA GAAGTCC GCCGCCACCATGCACCATCACCATCACCATCACCAT CACCATCAATCAGACATTGCGCAAGGAAAGAAGTCC GGCCACTATCGATGCATCAGATG CATCTGATGCATCGATAGTGGCC GTGTTTGGGCCGAGTGGGAT GCCATTGATTCGTCCGACTA TCTAGAAAGCTTTTATACTTCCCGGGCAACACTATT ... CCATCAGGAAGCGGCGCATCAACAATTG CGTCTTTG CTTATTTTAGATCAAGCAACCAGTGCC CTATATCAATTGCAGCGAGGCTTTCGACG AAATTGACTTCCGTAATGATG GGTGAACACGTTTCCGCTGTCGGTCCATCAGG GGACAATATCCTCTACTCCATTCCGCCTGAAATTGC CGTGCTATTGGAAAAGCTAATTCCACAAAATTTTTGGCC ... TCTAGAAAGCTTTTATACTTCCCGGGCAACACTATT GTCC TCTAGAAAGCTTTTAGTGATGGTGATGGTGATGGTG ATGCCGCCCTTCGATGCCGCCGCCGCCTACTTCCCGG GCAACACTATTGTCC GCCACTAGTTGGAGCCCTTCC GGCACTAGTATGCAATCAGACATTGCG CCATCAGGAAGCGGCGCATCAACAATTG...
  • 13
  • 615
  • 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Báo cáo khoa học

... has generally been related to their antibacterial activity [20], parabutoporin and opistoporin were tested on Gramnegative and Gram-positive bacteria and their activity was compared with the activity ... isolation and characterization of amphipathic a- helical peptides from the venom of Opistophtalmus carinatus, a scorpion living in southern Africa, and we have made a comparative analysis of the ... melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria tested except S marcescens at a concentration of Ó FEBS 2002 Fig Helical wheel diagram of parabutoporin...
  • 12
  • 598
  • 0
Tài liệu Determining the Cost of Producing Ethanol from Corn Starch and Lignocellulosic Feedstocks pot

Tài liệu Determining the Cost of Producing Ethanol from Corn Starch and Lignocellulosic Feedstocks pot

Cao đẳng - Đại học

... Area The utilities section appears small because the steam and cooling water capital was converted to variable operating costs and distributed among the areas Distillation and syrup concentration ... associated with handling baled stover is estimated to be large, and the labor is anticipated to be high 4) Having knowledgeable operations and laboratory staff was perceived to be one of the greatest ... $0.644 Raw Material Stream Corn Feedstock Caustic Alpha-Amylase Gluco-Amylase Denaturant (Gasoline) Sulfuric Acid Lime Makeup Water Urea Yeast Subtotal 1GRAIN CIP AAMYL GAMYL GAS ACID LIME MAKEUP...
  • 44
  • 762
  • 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

Báo cáo khoa học

... typical of archaeal promoters had been observed These sequences are part of the basal transcriptional apparatus, such as the TATA box, centered at )27 from the transcriptional start site, and the ... (22.8 kDa) and the RNAse A (15.6 kDa) were used as molecular weight standards Analytical methods for protein characterization Protein concentration was determined using BSA as the standard [29] ... chromatography has shown that the protein can shift from a monomer to a multimeric form depending on the protein concentration and the temperature On the basis of the data reported in the literature on the...
  • 11
  • 565
  • 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khoa học

... developmental cycle: early, middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage ... amino acid sequences used to design degenerate primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background ... 20 s and 70 °C for min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our...
  • 11
  • 703
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25