Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion Simone Gompf1, Ariane Zutz1, Matthias Hofacker1, Winfried Haase2, Chris van der Does1 ´ and Robert Tampe1 Institute of Biochemistry, Biocenter, Johann Wolfgang Goethe-University, Frankfurt am Main, Germany Max-Planck Institute of Biophysics, Structural Biology, Frankfurt am Main, Germany Keywords ABC transporter; ER targeting; membrane protein trafficking transport ATPase; mitochondrial import; mitochondrial targeting sequence Correspondence ´ R Tampe, Institute of Biochemistry, Biocenter, Johann Wolfgang GoetheUniversity, Max-von-Laue-Strasse 9, D-60348 Frankfurt am Main, Germany Fax: +49 (0) 69 798 29495 Tel: +49 (0) 69 798 29475 E-mail: tampe@em.uni-frankfurt.de Website: http://www.biochem uni-frankfurt.de (Received 25 May 2007, revised July 2007, accepted 20 August 2007) The ATP-binding cassette transporter MDL1 of Saccharomyces cerevisiae has been implicated in mitochondrial quality control, exporting degradation products of misassembled respiratory chain complexes In the present study, we identified an unusually long leader sequence of 59 amino acids, which targets MDL1 to the inner mitochondrial membrane with its nucleotidebinding domain oriented to the matrix By contrast, MDL1 lacking this leader sequence is directed into the endoplasmic reticulum membrane with the nucleotide-binding domain facing the cytosol Remarkably, in both targeting routes, the ATP-binding cassette transporter maintains its intrinsic properties of membrane insertion and assembly, leading to homooligomeric complexes with similar activities in ATP hydrolysis The physiological consequences of both targeting routes were elucidated in cells lacking the mitochondrial ATP-binding cassette transporter ATM1, which is essential for biogenesis of cytosolic iron-sulfur proteins The mitochondrial MDL1 complex can complement ATM1 function, whereas the endoplasmic reticulumtargeted version, as well as MDL1 mutants deficient in ATP binding and hydrolysis, cannot overcome the Datm1 growth phenotype doi:10.1111/j.1742-4658.2007.06052.x ATP-binding cassette (ABC) transporters belong to a large family of membrane proteins found in all three kingdoms of life The chemical energy of ATP is used to drive uphill transport of a broad range of solutes across membranes [1–3] ABC transporters have a conserved domain organization consisting of two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs) The TMDs form a translocation pore, whereas the NBDs catalyze ATP hydrolysis The ABC half-transporter multidrug resistance like protein (MDL1), composed of a TMD followed by a NBD, is located in the inner mitochondrial membrane (IMM) of Saccharomyces cerevisiae It has been suggested to be involved in the export of 6-mer to 20-mer peptides, derived from proteolysis of nonassembled inner membrane proteins by the m-AAA (i.e matrixoriented ATPase associated with a variety of cellular activities) protease [4] It has been further reported that MDL1 mediates resistance against oxidative stress and can partially complement the function of ABC transporter of mitochondria (ATM) [5] Deletion of ATM1 in S cerevisiae results in a severe growth defect because ATM1 is essential for the biogenesis of cytosolic iron-sulfur (Fe-S) proteins [6] Abbreviations ABC, ATP-binding cassette; ATM, ABC transporter of mitochondria; ER, endoplasmic reticulum; 5-FOA, 5-fluoroorotic acid; IMM, inner mitochondrial membrane; MDL1, multidrug resistance like protein 1; MTS, mitochondrial targeting signal; NBD, nucleotide-binding domain; SC, synthetic complete; TIM, translocase of the inner mitochondrial membrane; TOM, translocase of the outer mitochondrial membrane; TMD, transmembrane domain 5298 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS S Gompf et al Mitochondria contain approximately 800–1500 different proteins [7,8] Although they include mtDNA and a transcription ⁄ translation machinery, the vast majority of mitochondrial proteins are encoded by nuclear genes and synthesized as precursor proteins on cytosolic ribosomes [9–13] Several pathways of mitochondrial protein import have been characterized: (a) the presequence pathway for matrix proteins; (b) sorting and assembly of anchored mitochondrial outer membrane proteins by transmembrane b-strands, and (c) the carrier pathway for hydrophobic inner membrane proteins [14] The mitochondrial targeting signal (MTS) of proteins directed to the IMM is recognized by receptors of the translocase of the outer mitochondrial membrane (TOM complex) The classical targeting signal is represented by an N-terminal leader sequence of 20– 35 amino acids [15], enriched in basic, hydrophobic and hydroxylated residues [16] It has been suggested that the leader peptide folds into a defined secondary structure, which is essential for protein import, due to the distribution of charged and apolar residues The N-terminal part of the MTS forms a positively charged amphiphilic a-helix or b-sheet, whereas the C-terminal region probably serves as a recognition site for matrix proteases [15,17] Positional amino acid preferences have been found in the region immediately upstream from the mature amino terminus [18] In particular, arginine can be enriched in position -2, -3, -10, and -11 relative to the cleavage site The leader sequence interacts with the TOM receptor, responsible for the translocation of the preproteins to the translocase of the inner mitochondrial membrane (TIM)23 complex located in the IMM The presequence translocase-associated motor is directly associated with TIM23 and completes the translocation of the preprotein into the matrix There the presequence is removed by the mitochondrial processing peptidase Subsequently, IMM proteins are guided by a hydrophobic sorting sequence that typically follows the positively charged presequence [19,20] In the present study, we addressed the functional role and physiological consequences of the unusual long N-terminal leader sequence of MDL1 Fulllength MDL1 is targeted to the IMM, whereas the leaderless ABC transporter is exclusively inserted into endoplasmic reticulum (ER) membrane Despite these presequence-dependent trafficking routes, the membrane insertion, the complex assembly, and the ATPase function of MDL1 are preserved The physiological consequence of these two targeting routes is addressed by in vivo complementation in cells lacking the mitochondrial ABC transporter Membrane targeting on demand ATM1, which is essential for the assembly of cytosolic Fe-S proteins Results Targeting of MDL1 to the IMM It has been postulated that MDL1 is involved in the export of peptides generated (e.g from misassembled mitochondrially encoded respiratory chain subunits) [4] Unfortunately, the mechanism and transported substrate remain largely elusive due to the intrinsic difficulties in studying mitochondrial export processes This is due to the fact that substrates are limited in the matrix and their concentrations are very difficult to control experimentally In addition, substrates are highly diluted after translocation into the external medium By contrast, many intracellular transport systems have been characterized in detail by means of uptake assays; for example, the transporter associated with antigen processing (TAP) [21,22] and TAP-like (ABCB9) [23] We therefore set out to target MDL1 from mitochondrial import to insertion into the ER membrane in order to perform similar analyses An introduced ClaI restriction site and the endogenous BamHI site divided the MDL1 gene into three cassettes, facilitating the exchange of segments between different constructs By means of the inducible GAL1promoter, the protein can be over-produced to a level of approximately 1% of the total mitochondrial protein This correlates with an over-expression compared to native MDL1 of up to 100-fold To determine the localization of MDL1 in S cerevisiae, mitochondria of Dmdl1 ⁄ MDL1 cells were prepared by subcellular fractionation As shown in Fig 1A, MDL1 is found in the mitochondrial fraction even after over-expression Immunoblotting of marker proteins (TIM23 and SEC61) confirms that the mitochondrial fraction contains only traces of ER membranes In addition, we analyzed the subcellular localization of MDL1 by immunogold labeling (Fig 1B) As expected, MDL1 was detected exclusively in cristae membranes, demonstrating that the nuclear encoded protein is post-translationally targeted to mitochondria Identical results were obtained using a C-terminally His-tagged version of MDL1 (data not shown) Post-translational maturation of MDL1 Mitochondrial ABC transporters not exhibit significant sequence similarities in their leader sequences In the case of MDL1, several algorithms for the prediction of mitochondrial targeting sequences gave rather FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5299 Membrane targeting on demand S Gompf et al A B C Fig Localization of full-length and leaderless MDL1 in S cerevisiae ER and mitochondrial membranes were prepared from cells over-expressing wild-type MDL1 and leaderless MDL1(60-695) (A) and analyzed by SDS ⁄ PAGE (10%) and immunoblotting using antibodies specific for MDL1, the mitochondrial maker TIM23 and the ER marker SEC61 Immunogold labeling of sections through cells over-expressing wild-type MDL1 (B) and leaderless MDL1(60-695) (C) Full-length MDL1 is localized in the mitochondrial cristae membranes, whereas leaderless MDL1 is detected in tubulo-vesicular membranes belonging to or deriving from the endoplasmic reticulum M, mitochondria; N, nucleus; V, vacuole conflicting results We therefore set out to examine the post-translational modification experimentally After purification via a C-terminal His-tag from isolated mitochondria (Fig 2A), N-terminal sequence of MDL1 was determined by Edman degradation An unusually long presequence of 59 amino acids was identified The N-terminus (position 2–6) of the isolated, mature ABC transporter (ESDIAQ) matches perfectly with residue S61 to Q65 (Swiss-Prot: P33310) Surprisingly, we found that the glutamine expected at position 60 (the newly generated N-terminus) had been modified to a glutamate Sequencing of the expression construct and comparison with the protein data bank confirmed the glutamine at position 60 We can further exclude modifications during purification because MDL1 was prepared from isolated mitochondria Taken together, we identified two post-translational modifications of MDL1: first, cleavage after residue 59 in the mitochondrial matrix releasing a long presequence and, second, an enzymatic deamidation of the newly generated N-terminal glutamine to glutamate Such modification has been reported for cytosolic proteins (N-end rule pathway) [24] and for at least two mitochondrial proteins, TIM44 and COX4 [25,26] To date, it is not clear whether this modification is an artifact of Edman degradation or whether this deamidation is catalyzed by a N-terminal amidase during mitochondrial translocation 5300 We next examined the membrane targeting of MDL1 lacking the mitochondrial leader sequence identified in the present study Thus, MDL1(60-695) was generated and expressed in S cerevisiae By contrast to the full-length protein, we found leaderless MDL1 cofractionated with the ER marker SEC61 (Fig 1A) As a control, the mitochondrial marker TIM23 is found only in the mitochondrial fraction, whereas SEC61 is enriched in the ER fraction, but can also be found in the mitochondrial fraction In parallel, the subcellular localization of leaderless MDL1 was confirmed by immunogold labeling (Fig 1C) MDL1 lacking the MTS was detected in tubulo-vesicular membranes resembling the yeast ER membrane It is worth mentioning that the N-terminally tagged MDL1(60-695) was also targeted to the ER, as demonstrated by subcellular fractionation and immunogold labeling (data not shown) This suggests that mistargeting is due to of a lack of the leader sequence rather than the new N-terminus Collectively, these data demonstrate that leaderless MDL1 is targeted to and inserted into the ER membrane by a cryptic default pathway Directionality of membrane insertion The orientation of the full-length and leaderless ABC transporter in mitochondrial and ER membranes, respectively, was examined by protease protection FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS S Gompf et al Membrane targeting on demand A IMMs, demonstrating that the ABC transporter was inserted with the NBDs oriented to the matrix (Fig 3B) By contrast to full-length MDL1 expressed in the IMM, trypsin treatment of ER membranes containing leaderless MDL1 resulted in a limited digestion of MDL1 (Fig 3C) Trypsin treatment digestion of ABC half-transporters resulted in the cleavage of the linker region between TMD and NBD [27] Even at lgỈmL)1 of trypsin, the NBDs of MDL1 were specifically cleaved, indicating that they were oriented in the cytoplasm In conclusion, the NBDs of mitochondrial MDL1 are located in the matrix, whereas the NBDs of the leaderless MDL1 targeted to the ER membrane face the cytosol B MDL1 forms homooligomeric complexes with similar activities independent of the targeting route Fig Purification of MDL1 For purification of MDL1 (A) and MDL1(60-695) (B) with C- or N-terminal His-tags, respectively, total membranes were prepared from S cerevisiae over-expressing the protein Membranes (10 mgỈmL)1) were solubilized in the presence of 1% (w ⁄ v) digitonin The protein was purified to homogeneity by metal affinity chromatography Pellet (P) and supernatant after solubilization (S), flow-through (FT), and fractions with increasing concentrations of imidazole were analyzed by SDS ⁄ PAGE (10%, Coomassie Blue stained, upper panel) and immunoblotting with anti-MDL1 serum (lower panel) assays As expected, MDL1 targeted to the IMM was resistant to trypsin digestion because it was shielded by the outer mitochondrial membrane (Fig 3A) To determine the orientation of MDL1 in the IMM, mitoplasts and inverted IMMs were prepared and assayed for protease cleavage A factor Xa cleavage site was engineered at the C-terminus of MDL1 before the His8-tag Thus, if the C-terminus is accessible to the protease, the His-tag will be cleaved off as detected by immunoblotting with His-tag specific antibodies This way, MDL1 in mitoplasts was shown to be protected against factor Xa cleavage, whereas the C-terminus of MDL1 was accessible in the inverted ABC half-transporters must assemble at least into dimeric complexes to gain function To analyze whether both targeting routes are comparable in complex assembly and ATPase activity, the full-length and leaderless MDL1 were purified to homogeneity via metal affinity chromatography, yielding approximately 20 lgỈg)1 wet weight of yeast in both cases (Fig 2) After isolation from different cellular compartments, we investigated complex formation of MDL1 by gel filtration Each fraction was subsequently analyzed by SDS ⁄ PAGE and immunoblotting (Fig 4A) The mitochondrial as well as ER-resident MDL1 forms homooligomeric complexes of similar size The broad distribution is rather typical for digitonin solubilized ABC transport complexes Notably, no protein aggregates were detected at the exclusion volume Other detergents resulted in MDL1 complexes, which rapidly lost their ATPase activity [28] To demonstrate that the broad distribution is not due to misfolding, we performed an alternative approach, where we investigated the oligomeric state of MDL1 by Blue-Native electrophoresis (Fig 4B) Full-length and leaderless MDL1 solubilized from yeast membranes migrate as defined bands at approximately 250 kDa, which corresponds to a homodimeric complex, as resolved by single particle electron microscopy analysis [28] In summary, MDL1 forms a homodimeric complex independent of its subcellular targeting The ATPase activity of ABC half-transporters is critically dependent on the complex formation We therefore compared the ATPase activity of MDL1 targeted to different cellular compartments (Fig 5A,B) Mitochondrial MDL1 isolated from total membranes was active in ATP hydrolysis with a Km ATP of FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5301 Membrane targeting on demand A S Gompf et al B Fig Membrane orientation of mitochondrial and ER-resident MDL1 Mitochondrial (A) and ER fractions (C) (30 lg each) containing wild-type MDL1 and leaderless MDL1(60-695), respectively, were incubated with increasing concentrations of trypsin (0–0.1 mgỈmL)1) and analyzed by SDS ⁄ PAGE (10%) followed by immunoblotting (B) Mitoplasts and inverted IMMs (IMV) (30 lg each) containing MDL1 were incubated with factor Xa (0.5 lg) and analyzed by SDS ⁄ PAGE (10%) and immunoblotting In this case, MDL1 contains a C-terminal His-tag separated by a factor Xa cleavage site C A Fig Formation of homooligomeric complexes of mitochondrial and ER-resident MDL1 Purified MDL1 (upper panel) and leaderless MDL1(60-695) (lower panel) were analyzed by gel filtration on a Superdexä 200 PC 3.2 in the presence of 0.1% (w ⁄ v) digitonin Every second fraction (30 lL) was analyzed by immunoblotting using an MDL1-specific antibody (A) Total membranes (10 mgỈmL)1) of cells expressing MDL1 or MDL1(60-695) were solubilized in presence of 1% (w ⁄ v) digitonin (B) Digitonin-solubilized proteins were analyzed by Blue-Native electrophoresis and immunoblotting using anti-MDL1 serum Apoferritin (443 kDa), b-amylase (200 kDa), alcohol dehydrogenase (150 kDa), and albumin (66 kDa) were used as markers B 120 ± lm and a turnover rate kcat of 74 ± ATPỈ min)1 (per monomer) In comparison, leaderless MDL1 purified from microsomes showed a Km ATP of 200 ± lm and a kcat of 77 ± ATPỈmin)1 (per monomer) To exclude the possibility that the activity is caused by contaminating ATPases, we expressed and purified two MDL1 variants (E599Q and H631A), each of which has a disrupted catalytic dyad MDL1(E599Q) and MDL1(H631A) show no ATPase activity above background but are active in ATP binding [28] We further examined whether MDL1 show 5302 similar sensitivity towards vanadate inhibition in both targeting routes As shown in Fig 5C,D, the ATPase activity of MDL1 purified from mitochondria or ER membranes was inhibited in a dose-dependent manner by ortho-vanadate Comparable to other ABC transporters [29–31], the IC50 values of 0.86 mm and 1.1 mm were determined for the mitochondrial and ER-resident MDL1, respectively Taken together, fulllength and leaderless MDL1 are comparable in respect to assembly of homooligomeric complexes, ATPase activity, and vanadate inhibition FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS S Gompf et al Membrane targeting on demand Fig ATPase activity and vanadate inhibition of purified MDL1 ATPase activities were measured as a function of ATP concentration for 10 at 30 °C with 0.5 lM of purified protein MDL1 (A) and MDL1(60-695) (B) showed Michaelis– Menten kinetics with a Km ATP of 120 ± lM and 200 ± lM and a kcat of 74 ± ATPỈmin)1 and 77 ± ATPỈmin)1 (per MDL1 monomer), respectively Inhibition of ATPase activity of MDL1 (C) and MDL1(60-695) (D) by different concentrations of ortho-vanadate (given in lM) Based on the curve fit half-maximal inhibitory concentrations (IC50) of 860 lM and 1.1 mM were determined All values are derived from triplicate measurements Uptake assays with isolated microsomes containing MDL1 Leaderless MDL1 is targeted to ER membranes, where the NBDs of the homooligomeric complex are oriented to the cytosol In this orientation, the ATP level and substrates can effectively be controlled To identify the MDL1 substrate, we screened combinatorial peptide libraries of different length Xn (n ¼ 5–8, 11, 17, and 23, where X represents an equimolar distribution of all 19 amino acids except cysteine) These libraries have been instrumental in deciphering the substrate specificity of several eukaryotic and prokaryotic ABC transporters [21,23,32,33] In addition, we analyzed a set of defined peptides expected to be a putative substrate of MDL1 These include, for example, N-formylated peptides or fragments of mitochondrially encoded gene products, which have been identified as minor antigens [34] Systematic uptake assays with these peptidic substrates, however, showed no MDL1-specific transport activity, suggesting that MDL1 may be not a general peptide transporter such as TAP or TAP-like, but most likely transports a very specific or even modified peptide Physiological function of MDL1 targeted to different membranes As shown in Fig 6, MDL1 complements the severe growth defect of Datm1 cells, indicating that the ABC transporter can at least partially restore the assembly of essential cytosolic Fe-S proteins We next generated a set of mutants defective in ATP binding and hydrolysis Mutation of the conserved lysine in the Walker A motif (K473A) is known to inhibit ATP binding, whereas substitutions in the catalytic dyad (E599Q or H631A) inhibit ATP hydrolysis [35–37] Importantly, these three mutants did not complement the Datm1 phenotype Together with in vitro experiments these data demonstrate for the first time that ATP binding and hydrolysis are required for MDL1 function It has very recently been shown that the ATPase activity of ATM1 is stimulated by cysteine-containing peptides [38] We therefore generated a cysteine-less MDL1 and examined its function by in vivo complementation Datm1 ⁄ MDL1(Cys-less) cells found to be viable, demonstrating that cysteine residues are not essential for MDL1 function By contrast to wild-type MDL1, the leaderless protein did not restore ATM1 function Taken together, the function of MDL1 in rescuing the cytosolic Fe-S cluster assembly machinery requires ATP binding and hydrolysis and is strictly coupled to its post-translational targeting to the mitochondrial membrane Discussion Most mitochondrial proteins are synthesized by free ribosomes in the cytosol Once released into the cytoplasm with an N-terminal MTS, these preproteins are imported into the mitochondria post-translationally [39] MTS usually consists of 20–35 residues and is highly degenerated in primary sequence, but is rich in basic, hydrophobic and hydroxylated residues and FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5303 Membrane targeting on demand S Gompf et al Fig Physiological function of MDL1 variants analyzed by in vivo complementation Datm1 ⁄ ATM1 + MDL1 cells were plated on SCD without uracil and tryptophan and used for replica plating Selection plates containing 5-FOA were incubated at 30 °C for days MDL1 can complement the severe growth defect of Datm1 cells, whereas mutants K473A, E599Q, H631A, inactive in ATP binding or hydrolysis, as well as MDL1(60-695) not show complementation of ATM1 MDL1(Cys-less) is able to take over the function of ATM1 and not affect growth generally lacks acidic amino acids [16] For post-translational targeting of MDL1 to the IMM, a 59 amino acid long mitochondrial leader sequence was identified, which is cleaved in the matrix Subsequently, the resulting N-terminal glutamine is converted to a glutamate Limited protease protection assays confirmed that MDL1, even after over-expression, is efficiently imported into mitochondria and properly inserted into as well as assembled in the IMM with the NBDs facing the mitochondrial matrix Based on sequence comparison, MDL1 should function as an exporter of solutes to the intermembrane space It is worth noting that murine ABCB10, the closest homolog of MDL1, also possesses an exceptionally long presequence of 5304 105 amino acids [40] Membrane topology algorithms predict either five or six transmembrane helices for MDL1 Protease accessibility assays and post-translational modifications revealed that the NBD and the highly positively charged N-terminus of mature MDL1 are located in the mitochondrial matrix Based on these data, we propose that MDL1 comprises six transmembrane helices In the present study, we addressed the functional role of the unusually long leader sequence of MDL1 in its subcellular targeting and physiological consequences By contrast to the full-length protein, which is efficiently imported into mitochondria, leaderless MDL1 is exclusively targeted to ER membranes FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS S Gompf et al Protease accessibility assays demonstrated that the NBDs of the ER-resident transporter are oriented to the cytosol The localization is not influenced by additional C- or N-terminal His-tags either for full-length or leaderless MDL1 To exclude that full-length and leaderless MDL1 have different activities, the proteins were purified to homogeneity (Fig 2) Remarkably, full-length and leaderless MDL1 form homooligomeric complexes of the same size and similar ATPase activities, Km ATP values of 120 lm and 200 lm and kcat values of 74 ATPỈmin)1 and 77 ATPỈmin)1 (per MDL1 subunit), respectively The ATPase activity of the transport complex is in very good agreement with data of the mitochondrial ABC transporter ATM1 [38] and the purified NBD of MDL1 [36] Both full-length and leaderless MDL1 show sensitivity to ortho-vanadate, similar to other ABC transporters [29–31] MDL1 over-expressed in microsomes provides an optimal setting to study the substrate specificity and function of this sparingly characterized ABC transporter Based on a rather indirect assay, it has previously been concluded that MDL1 exports peptides of 6–20 amino acids in length [4] To our surprise, no transport activity was observed for microsomal MDL1 by screening combinatorial peptide libraries of different lengths (Xn, n ¼ 5–23 amino acids) Notably, this approach has been crucial in the identification of the substrate specificity of other peptide transporters [21,23,32,33,41] In addition, defined peptides favored by the homologous TAP complex, such as the peptide RRYQKSTEL, are not transported by MDL1 Recently, a peptidic fragment, named COXI, of a mitochondrially encoded subunit of the cytochrome oxidase was identified to be presented on MHC class I molecules of murine cells [42] It was suggested that COXI is transported from the matrix to the cytosol, where the peptide is funneled into the pathway of MHC class I antigen processing [34,43] Thus, N-terminal 7-, 9- and 12-mer fragments of COXI were analyzed for an MDL1-dependent transport activity However, no uptake was detected Taken together, these findings suggest that MDL1, if indeed a peptide transporter, is highly specific for a small set of peptides or even modified peptides largely under-represented in the peptide libraries These systematic studies point to an intriguing possibility that MDL1 may require additional factors for substrate transfer Such factors may be absent in uptake studies or in the libraries used Similar ATPase activities prove that the NBDs of both MDL1 variants are correctly folded, although it cannot be excluded that their TMDs are influenced by the lipid compositions of the corresponding membranes Membrane targeting on demand Based on the important role of ATM1 in the biogenesis of cytosolic Fe-S proteins, Datm1 cells show a severe growth phenotype When Datm1 ⁄ ATM1 cells are forced to loose the plasmid-encoded ATM1 (URA3 marker) by growth on 5-fluoroorotic acid (5-FOA), Datm1 cells are almost nonviable Multicopy expression of MDL1 (Datm1 ⁄ MDL1) can rescue this phenotype and cells are viable on fermentable carbon sources [5] This implies that ATM1 and MDL1 have an overlapping function by which the growth phenotype of Datm1 cells is abrogated However, by contrast to ATM1 [38], no stimulation of the ATPase activity of MDL1 was observed with thiol-containing peptides of 10–15 residues in length (data not shown) A recent report suggested that thiol-containing molecules are first translocated by ATM1 and afterwards oxidized by ERV1 These events are necessary for the maturation of cytosolic and nuclear Fe-S proteins [38] However, a functional overlap between ATM1 and MDL1 with regard to the translocation of thiol-containing peptides appears to be very unlikely By analyzing several mutants, we demonstrated for the first time that ATP binding and ATP hydrolysis are required for the export function of MDL1 These results are supported by data obtained in vitro showing that the mutants K473A, E599Q and H631A are inactive in ATP hydrolysis [28] Notably, cysteine-less MDL1 rescues ATM1 function, demonstrating that cysteines are not essential for substrate translocation across the IMM by MDL1 The conclusion that cysteines are not involved in substrate translocation is also in line with the observation that the ATPase activity of MDL1 is not stimulated by cysteine-containing peptides (see above) Leaderless MDL1, although correctly assembled and fully active in ATP hydrolysis, does not complement the growth phenotype of Datm1 cells This finding attests that the physiological function of the ABC transporter MDL1 is intimately linked to its correct targeting to the IMM Experimental procedures Materials A rabbit polyclonal antibody was generated against the C-terminal 15 amino acids (KGGVIDLDNSVAREV) of MDL1 from S cerevisiae Cloning and expression of MDL1 The MDL1 gene from S cerevisiae was divided into three cassettes, separated by a newly generated silent ClaI restriction site at S221 and the endogenous BamHI site at K422 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5305 Membrane targeting on demand S Gompf et al Table Primers used for generating MDL1 constructs f, forward primer; r, reverse primer; mut, mutagenesis primer (exchanged bases underlined) Primer Sequence Sitea p1(f) GGTACCACTAGTGCCGCCACCATGGTTGTAAGAAT GATACGTCTTTGTAAAGG GCCGCCACCATGCAATCAGACATTGCGCAAGGAAA GAAGTCC GCCGCCACCATGCACCATCACCATCACCATCACCAT CACCATCAATCAGACATTGCGCAAGGAAAGAAGTCC GGCCACTATCGATGCATCAGATG CATCTGATGCATCGATAGTGGCC GTGTTTGGGCCGAGTGGGAT GCCATTGATTCGTCCGACTA TCTAGAAAGCTTTTATACTTCCCGGGCAACACTATT GTCC TCTAGAAAGCTTTTAGTGATGGTGATGGTGATGGTG ATGCCGCCCTTCGATGCCGCCGCCGCCTACTTCCCGG GCAACACTATTGTCC GCCACTAGTTGGAGCCCTTCC GGCACTAGTATGCAATCAGACATTGCG CCATCAGGAAGCGGCGCATCAACAATTG CGTCTTTG CTTATTTTAGATCAAGCAACCAGTGCC CTATATCAATTGCAGCGAGGCTTTCGACG AAATTGACTTCCGTAATGATG GGTGAACACGTTTCCGCTGTCGGTCCATCAGG GGACAATATCCTCTACTCCATTCCGCCTGAAATTGC CGTGCTATTGGAAAAGCTAATTCCACAAAATTTTTGGCC KpnI, SpeI, NcoI p1B(f) p1C(f) p1(r) p2(f) p2(r) p3(f) p3(r) p3B(r) p4(r) p5(f) pK473A(mut) pE599Q(mut) pH 631 A(mut) pC257S(mut) pC464S(mut) pC531S(mut) pC552S(mut) a Restriction endonuclease site introduced by primer b XbaI, HindIII SpeI SpeI The BamHI site is found up- or downstream of the primer [28] Cassette I includes the N-terminal part of the TMD (M1 to A220), cassette II the C-terminal part of the TMD (S221 to K422), and cassette III the NBD of MDL1 (D423 to V695) Furthermore, leaderless MDL1 (cassette IB, Q60 to A220) was generated The different cassettes of MDL1 were amplified from genomic DNA (for sequences of the primers, see Table 1) The corresponding PCR fragments were cloned downstream of the GAL1-promoter in the pYES2.1 ⁄ V5-His-TOPOÒ expression vector (Invitrogen, Carlsbad, CA, USA) resulting in plasmids pMDL1 and pMDL1(60-695) Using primers p1C(f) and p3(r), a similar approach was applied to insert an N-terminal His10-tag followed by leaderless MDL1(60-695) resulting in pMDL1(60695,His) pMDL1(His), comprising four glycines, a factor Xa cleavage site, and a His8-tag downstream of MDL1, was generated with primers p1(f) and p3B(r) Plasmids were transformed into Dmdl1 strain Y24137 (BY4743; Mat a ⁄ a; his3D1 ⁄ his3D1; leu2D0 ⁄ leu2D0; lys2D0 ⁄ LYS2; MET15 ⁄ met15D0; ura3D0 ⁄ ura3D0; YLR188w:: kanMX4 ⁄ YLR188w) [44] Transformed cells were cultured at 30 °C in synthetic complete (SC) medium in the presence of 2% (w ⁄ v) glucose without uracil [45] Cultures were diluted to an A600 nm of 0.4 in SC medium containing 2% (w ⁄ v) galactose and growth was continued for 12 h Cells were harvested by centrifugation and immediately used for the isolation of total membranes [46] or mitochondria 5306 ClaI ClaI BamHIb BamHIb XbaI, HindIII [28,47] Microsomes were separated from mitochondria by centrifugation of the resulting supernatant at 100 000 g for 45 at °C (Ti45, Beckman Coulter, Fullerton, CA, USA) Mitoplasts and inverted inner mitochondrial vesicles are prepared as described [48,49] The proteins were analyzed by SDS ⁄ PAGE and immunodetection using the MDL1specific antibody Protein concentrations were determined using the Bradford assay (Pierce, Rockford, IL, USA) Immunogold labeling S cerevisiae expressing full-length MDL1 or leaderless MDL1(60-695), with and without the corresponding Histags, were fixed with 4% paraformaldehyde in 0.1 m sodium cacodylate buffer (pH 7.2) supplemented with 0.8 m sorbitol, mm MgCl2 and mm CaCl2 with or without 1% glutardialdehyde After h, the fixative was exchanged for cacodylate buffer containing decreasing concentrations of sorbitol (0.5, 0.25, m; three times 10-min incubation for each concentration) Cells were treated with 1% sodium meta-periodate, washed in water, and incubated in 0.05 m NH4Cl After 12 h, cells were washed again and enclosed in agar-agar, which then was cut into small slices and passed through increasing concentrations of ethanol for dehydration Samples were stepwise infiltrated with LR White resin FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS S Gompf et al (London Resin Company Ltd, Reading, UK) and polymerized for 30 h at 55 °C Thin sections were cut from the resin bloc and transferred onto formvar-coated nickel grids For immunogold labeling, grids were placed on drops of the respective solutions in the following order: saturated sodium meta-periodate; water; NaCl ⁄ Pi containing 2% glycine; NaCl ⁄ Pi; NaCl ⁄ Pi containing 1% BSA, 0.1% Tween 20, NaCl ⁄ Pi, 0.1% BSA, 0.05% Tween 20 Sections were incubated with the anti-MDL1 serum After removal of unbound antibodies, sections were incubated with secondary goat anti-rabbit serum coupled to gold particles (diameter of 10 nm) Carefully washed slices were briefly treated with 1% glutardialdehyde in NaCl ⁄ Pi and, after contrasting with uranyl acetate and lead citrate, preparations were analyzed by electron microscopy (EM 208S, FEI Company, Eindhoven, the Netherlands) Blue-Native PAGE Total membranes (10 mgỈmL)1) were solubilized in digitonin buffer [20 mm Tris ⁄ HCl pH 7.4, 50 mm NaCl, 10% (v ⁄ v) glycerol, mm EDTA, mm phenylmethanesulfonyl fluoride, 1% (w ⁄ v) digitonin (Calbiochem, Darmstadt, Germany)] for h at °C under gentle rotation Loading dye (10 mm Bis-Tris pH 7, 50 mm e-amino-n-caproic acid, 5% (w ⁄ v) Coomassie Blue (G) was added to solubilized material after ultracentrifugation (100 000 g, 30 min, °C) [28] Blue-Native electrophoresis (gradient 6.0–16.5%) was performed as previously described [50] Apoferritin (443 kDa), b-amylase (200 kDa), alcohol dehydrogenase (150 kDa), and albumin (66 kDa) were used as markers Limited trypsin digestion and factor Xa cleavage To determine the membrane orientation of MDL1 in isolated organelles, 15 lg of organelles were incubated for 15 on ice with increasing concentrations of trypsin (up to 0.1 mgỈmL)1) Proteolysis was stopped by addition of trichloroacetic acid to a final concentration of 7.5% (v ⁄ v) After subsequent centrifugation, pellets were washed with ice-cold acetone and resuspended in sample buffer [51] For factor Xa cleavage, mitoplasts and inverted IMMs (30 lg) were incubated with 0.01 mgỈmL)1 factor Xa in 20 mm Tris ⁄ HCl pH 8.0, 100 mm NaCl, and mm CaCl2 for 30 at 25 °C The reaction was stopped by addition of sample buffer and incubation for 10 at 65 °C The accessibility to trypsin and factor Xa was determined by immunodetection with MDL1-specific and anti-His-tag (Novagen, San Diego, CA, USA) sera Purification of MDL1 Total membranes (10 mgỈmL)1) were solubilized in buffer A (20 mm Tris ⁄ HCl pH 8.0, 150 mm NaCl, 15% (v ⁄ v) Membrane targeting on demand glycerol, EDTA-free complete protease inhibitor cocktail (final concentration according to manufacturer, Roche, Mannheim, Germany), 1% (w ⁄ v) digitonin (Calbiochem)) for h at °C under gentle rotation Nonsolubilized material was removed by ultracentrifugation (100 000 g, 30 min, °C; Ti80, Beckman Coulter) and the soluble fraction was loaded onto a mL Ni2+-High-Trap Chelating column (GE Healthcare, Piscataway, NJ, USA) equilibrated with buffer B (20 mm Tris ⁄ HCl pH 8.0, 150 mm NaCl, 15% (v ⁄ v) glycerol, mm imidazole, 0.1% (w ⁄ v) digitonin) After washing with buffer B containing 80 and 160 mm imidazole, the protein was eluted in buffer B containing 400 mm imidazole Gel filtration Full-length and leaderless MDL1 were analyzed by gel filtration on a Superdexä 200 PC 3.2 (GE Healthcare) equilibrated with SEC buffer (20 mm Tris ⁄ HCl pH 8.0, 150 mm NaCl and 0.1% (w ⁄ v) digitonin); 60 lg of protein was loaded at a flow rate of 50 lLỈmin)1 30 lL fractions were collected and analyzed by SDS ⁄ PAGE and immunoblotting using anti-MDL1 serum Ferritin (443 kDa), b-amylase (200 kDa), and BSA (70 kDa) in SEC buffer without detergent were used for calibration ATPase assays The ATPase activity was essentially determined as described [31] 20 mm dithiothreitol was added to lm purified MDL1 The reaction was started by addition of ATP containing buffer (20 mm Tris ⁄ HCl pH 8.0, 150 mm NaCl, 20 mm MgCl2, 0.1% (w ⁄ v) digitonin, 10 mm ATP traced (370 000 : 1) with [c-32P]ATP (specific activity 110 TBqỈ mmol)1; Hartmann Analytic, Braunschweig, Germany) in a : ratio at 30 °C The reaction was stopped after 10 by adding mL of 10 mm ammonium molybdate in m HCl Subsequently, 15 lL of 20 mm H3PO4 and mL of a butanol ⁄ cyclohexane ⁄ acetone (5 : : 1) mixture were added After rigorous vortexing, the organic phase was extracted and the radioactivity was quantified by liquid scintillation b-counting (Beckman LS6500 Liquid Scintillation Counter; Beckman Coulter Inc., Fullerton, CA, USA) Km ATP values were derived by fitting the data to the Michaelis–Menten equation Specific inhibition of the ATPase activity was analyzed at various concentrations of vanadate, using the charcoal adsorption method in combination with [c-32P]ATP [52] 0.5 lm of purified MDL1 was incubated with increasing concentrations of ortho-vanadate By addition of buffer supplemented with ATP, the reaction was initiated and incubated for 15 at 30 °C 750 lL of ice-cold 10% charcoal in 10 mm EDTA were added to terminate the reaction After rigorous agitation, reactions were incubated for h on ice to allow maximal binding of free ATP to the charcoal After FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5307 Membrane targeting on demand S Gompf et al centrifugation at 20 000 g for 15 min, the radioactivity of the supernatant was measured by b-counting in the presence of mL scintillation fluid Data were fitted to a dose–response equation and the half-maximal inhibitory concentration (IC50) was calculated (Eqn 1) 100%  activity ẵ% ẳ  orthovanadate ẵlM 1ỵ IC50 ẵlM 1ị Peptide transport Combinatorial peptide libraries and defined peptides were generated on a robot system by solid phase chemistry using Fmoc [N-(9-fluorenyl) methoxycarbonyl] amino acids, as previously described [41] Peptides and peptide libraries were radiolabeled and peptide transport was analyzed as described [53] with the following modifications: microsomes (75 lg of total protein) of the yeast strain Y06425 (BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YLL048c::kanMX4), expressing MDL1(60-695), were incubated with lm 125 I-labeled peptides, mm ATP or U apyrase in 50 lL of AP buffer (NaCl ⁄ Pi, 0.1 mm DTT, mm MgCl2, pH 7.0) for at 30 °C The reaction was stopped by addition of icecold AP buffer (500 lL), supplemented with 10 mm EDTA After centrifugation and two washing steps, the radioactivity in microsomes was measured by c-counting (Cobra II; Packard Instrument Company, Meriden, CT, USA) Complementation assay DKY230 cells [5] were cultured on SCD plates without uracil and tryptophan and used for replica plating Selection plates containing SCD without tryptophan were supplemented with gỈL)1 of 5-FOA Resistant colonies appeared within 5–7 days at 30 °C [54] For 5-FOA in vivo screens, several MDL1 mutants were generated by using MDL1 plasmid [5] as template The mutants K473A, E599Q, and H631A were generated using the mutagenesis primers pK473A(mut), pE599Q(mut), and pH 631 A(mut), respectively To generate leaderless MDL1, primers p5(f) and p4(r) were used A Cys-less MDL1 construct was generated with the mutagenesis primers pC257S(mut), pC464S(mut), pC531S(mut) and pC552S(mut) Acknowledgements We are grateful to Drs Maja Chloupkova, David M Koeller (Oregon Health and Science University, Portland, OR, USA) and Peter Kotter (Goethe-Univeră sity, Institute of Microbiology, Frankfurt, Germany) for kindly providing yeast strains We thank Dr Peter Kotă ter for helpful discussions regarding yeast genetics This work was supported by the Deutsche Forschungsgemeinschaft (DFG) ) SFB472 Molecular Bioenergetics 5308 References Holland BI, Cole S, Kuchler K & Higgens C (2002) ABC Proteins ) From Bacteria to Man Academic Press, London Davidson AL & Chen J (2004) ATP-binding cassette transporters in bacteria Annu Rev Biochem 73, 241–268 ´ Schmitt L & Tampe R (2002) Structure and mechanism of ABC transporters Curr Opin Struct Biol 12, 754–760 Young L, Leonhard K, Tatsuta T, Trowsdale J & Langer T (2001) Role of the ABC transporter Mdl1 in peptide export from mitochondria Science 291, 2135–2138 Chloupkova M, LeBard LS & Koeller DM (2003) MDL1 is a high copy suppressor of ATM1: evidence for a role in resistance to oxidative stress J Mol Biol 331, 155–165 Lill R & Kispal G (2000) Maturation of cellular Fe-S proteins: an essential function of mitochondria Trends Biochem Sci 25, 352–356 Sickmann A, Reinders J, Wagner Y, Joppich C, Zahedi R, Meyer HE, Schonfisch B, Perschil I, Chacinska A, Guiard B et al (2003) The proteome of Saccharomyces cerevisiae mitochondria Proc Natl Acad Sci USA 100, 13207–13212 Taylor SW, Fahy E, Zhang B, Glenn GM, Warnock DE, Wiley S, Murphy AN, Gaucher SP, Capaldi RA, Gibson BW et al (2003) Characterization of the human heart mitochondrial proteome Nat Biotechnol 21, 281–286 Herrmann JM & Neupert W (2000) Protein transport into mitochondria Curr Opin Microbiol 3, 210–214 10 Jensen RE & Dunn CD (2002) Protein import into and across the mitochondrial inner membrane: role of the TIM23 and TIM22 translocons Biochim Biophys Acta 1592, 25–34 11 Endo T, Yamamoto H & Esaki M (2003) Functional cooperation and separation of translocators in protein import into mitochondria, the double-membrane bounded organelles J Cell Sci 116, 3259–3267 12 Koehler CM (2004) New developments in mitochondrial assembly Annu Rev Cell Dev Biol 20, 309–335 13 Wiedemann N, Frazier AE & Pfanner N (2004) The protein import machinery of mitochondria J Biol Chem 279, 14473–14476 14 Pfanner N, Wiedemann N, Meisinger C & Lithgow T (2004) Assembling the mitochondrial outer membrane Nat Struct Mol Biol 11, 1044–1048 15 Neupert W (1997) Protein import into mitochondria Annu Rev Biochem 66, 863–917 16 Schatz G & Dobberstein B (1996) Common principles of protein translocation across membranes Science 271, 1519–1526 17 Gavel Y & von Heijne G (1990) Cleavage-site motifs in mitochondrial targeting peptides Protein Eng 4, 33–37 18 Hendrick JP, Hodges PE & Rosenberg LE (1989) Survey of amino-terminal proteolytic cleavage sites in FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS S Gompf et al 19 20 21 22 23 24 25 26 27 28 29 30 31 mitochondrial precursor proteins: leader peptides cleaved by two matrix proteases share a three-amino acid motif Proc Natl Acad Sci USA 86, 4056–4060 Glick BS, Brandt A, Cunningham K, Muller S, Hallberg RL & Schatz G (1992) Cytochromes c1 and b2 are sorted to the intermembrane space of yeast mitochondria by a stop-transfer mechanism Cell 69, 809–822 Stuart R (2002) Insertion of proteins into the inner membrane of mitochondria: the role of the Oxa1 complex Biochim Biophys Acta 1592, 79–87 Uebel S, Kraas W, Kienle S, Wiesmuller KH, Jung G & ă Tampe R (1997) Recognition principle of the TAP transporter disclosed by combinatorial peptide libraries Proc Natl Acad Sci USA 94, 8976–8981 ´ Urlinger S, Kuchler K, Meyer TH, Uebel S & Tampe R (1997) Intracellular location, complex formation, and function of the transporter associated with antigen processing in yeast Eur J Biochem 245, 266–272 ´ Wolters JC, Abele R & Tampe R (2005) Selective and ATP-dependent translocation of peptides by the homodimeric ATP binding cassette transporter TAP-like (ABCB9) J Biol Chem 280, 23631–23636 Baker RT & Varshavsky A (1995) Yeast N-terminal amidase A new enzyme and component of the N-end rule pathway J Biol Chem 270, 12065–12074 Maarse AC, Van Loon AP, Riezman H, Gregor I, Schatz G & Grivell LA (1984) Subunit IV of yeast cytochrome c oxidase: cloning and nucleotide sequencing of the gene and partial amino acid sequencing of the mature protein EMBO J 3, 2831–2837 Weiss C, Oppliger W, Vergeres G, Demel R, Jeno P, Horst M, de Kruijff B, Schatz G & Azem A (1999) Domain structure and lipid interaction of recombinant yeast Tim44 Proc Natl Acad Sci USA 96, 8890–8894 Kashiwayama Y, Morita M, Kamijo K & Imanaka T (2002) Nucleotide-induced conformational changes of PMP70, an ATP binding cassette transporter on rat liver peroxisomal membranes Biochem Biophys Res Commun 291, 1245–1251 Hofacker M, Gompf S, Zutz A, Presenti C, Haase W, ´ van der Does C, Model K & Tampe R (2007) Structural and functional fingerprint of the mitochondrial ATPbinding cassette transporter Mdl1 from Saccharomyces cerevisiae J Biol Chem 282, 3951–3961 Urbatsch IL, Sankaran B, Bhagat S & Senior AE (1995) Both P-glycoprotein nucleotide-binding sites are catalytically active J Biol Chem 270, 26956–26961 Urbatsch IL, Sankaran B, Weber J & Senior AE (1995) P-glycoprotein is stably inhibited by vanadate-induced trapping of nucleotide at a single catalytic site J Biol Chem 270, 19383–19390 ´ Gorbulev S, Abele R & Tampe R (2001) Allosteric crosstalk between peptide-binding, transport, and ATP hydrolysis of the ABC transporter TAP Proc Natl Acad Sci USA 98, 3732–3737 Membrane targeting on demand 32 Detmers FJ, Lanfermeijer FC, Abele R, Jack RW, ´ Tampe R, Konings WN & Poolman B (2000) Combinatorial peptide libraries reveal the ligand-binding mechanism of the oligopeptide receptor OppA of Lactococcus lactis Proc Natl Acad Sci USA 97, 12487–12492 ´ 33 Doeven MK, Abele R, Tampe R & Poolman B (2004) The binding specificity of OppA determines the selectivity of the oligopeptide ATP-binding cassette transporter J Biol Chem 279, 32301–32307 34 Fischer Lindahl K, Hermel E, Loveland BE & Wang CR (1991) Maternally transmitted antigen of mice: a model transplantation antigen Annu Rev Immunol 9, 351–372 35 Smith PC, Karpowich N, Millen L, Moody JE, Rosen J, Thomas PJ & Hunt JF (2002) ATP binding to the motor domain from an ABC transporter drives formation of a nucleotide sandwich dimer Mol Cell 10, 139–149 36 Janas E, Hofacker M, Chen M, Gompf S, van der Does ´ C & Tampe R (2003) The ATP hydrolysis cycle of the nucleotide-binding domain of the mitochondrial ATPbinding cassette transporter Mdl1p J Biol Chem 278, 26862–26869 37 Zaitseva J, Jenewein S, Jumpertz T, Holland IB & Schmitt L (2005) H662 is the linchpin of ATP hydrolysis in the nucleotide-binding domain of the ABC transporter HlyB EMBO J 24, 1901–1910 38 Kuhnke G, Neumann K, Muhlenhoff U & Lill R (2006) ă Stimulation of the ATPase activity of the yeast mitochondrial ABC transporter Atm1p by thiol compounds Mol Membr Biol 23, 173–184 39 Miyazaki E, Kida Y, Mihara K & Sakaguchi M (2005) Switching the sorting mode of membrane proteins from cotranslational endoplasmic reticulum targeting to posttranslational mitochondrial import Mol Biol Cell 16, 1788–1799 40 Graf SA, Haigh SE, Corson ED & Shirihai OS (2004) Targeting, import, and dimerization of a mammalian mitochondrial ATP binding cassette (ABC) transporter, ABCB10 (ABC-me) J Biol Chem 279, 42954–42963 41 Uebel S, Meyer TH, Kraas W, Kienle S, Jung G, ´ Wiesmuller KH & Tampe R (1995) Requirements for ă peptide binding to the human transporter associated with antigen processing revealed by peptide scans and complex peptide libraries J Biol Chem 270, 18512– 18516 42 Morse MC, Bleau G, Dabhi VM, Hetu F, Drobetsky EA, Lindahl KF & Perreault C (1996) The COI mitochondrial gene encodes a minor histocompatibility antigen presented by H2-M3 J Immunol 156, 3301–3307 ´ 43 Herget M & Tampe R (2007) Intracellular peptide transporters in human ) compartmentalization of the ‘peptidome’ Pflugers Arch 453, 591–600 44 Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P & Boeke JD (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS 5309 Membrane targeting on demand 45 46 47 48 49 S Gompf et al set of strains and plasmids for PCR-mediated gene disruption and other applications Yeast 14, 115–132 Sherman F (1991) Getting started with yeast Methods Enzymol 194, 3–21 Palsdottir H & Hunte C (2003) Purification of cytochrome bc1 complex from yeast In Membrane Protein Purification and Crystallization: A Practical Guide (Hunte C, von Jagow G & Schagger H, eds), pp 191 ă 203 Academic Press, San Diego, CA Meisinger C, Sommer T & Pfanner N (2000) Purification of Saccharomcyes cerevisiae mitochondria devoid of microsomal and cytosolic contaminations Anal Biochem 287, 339–342 Fritz S, Rapaport D, Klanner E, Neupert W & Westermann B (2001) Connection of the mitochondrial outer and inner membranes by Fzo1 is critical for organellar fusion J Cell Biol 152, 683–692 Jascur T (1991) Import of precursor proteins into yeast submitochondrial particles Methods Cell Biol 34, 359– 368 5310 50 Schagger H (2001) Blue-native gels to isolate protein ă complexes from mitochondria Methods Cell Biol 65, 231–244 51 van der Does C, den Blaauwen T, de Wit JG, Manting EH, Groot NA, Fekkes P & Driessen AJ (1996) SecA is an intrinsic subunit of the Escherichia coli preprotein translocase and exposes its carboxyl terminus to the periplasm Mol Microbiol 22, 619–629 52 Tombline G & Fishel R (2002) Biochemical characterization of the human RAD51 protein I ATP hydrolysis J Biol Chem 277, 14417–14425 ´ 53 Chen M, Abele R & Tampe R (2003) Peptides induce ATP hydrolysis at both subunits of the transporter associated with antigen processing J Biol Chem 278, 29686– 29692 54 Boeke JD, Trueheart J, Natsoulis G & Fink GR (1987) 5-Fluoroorotic acid as a selective agent in yeast molecular genetics Methods Enzymol 154, 164–175 FEBS Journal 274 (2007) 5298–5310 ª 2007 The Authors Journal compilation ª 2007 FEBS ... in the cytoplasm In conclusion, the NBDs of mitochondrial MDL1 are located in the matrix, whereas the NBDs of the leaderless MDL1 targeted to the ER membrane face the cytosol B MDL1 forms homooligomeric. .. 1% of the total mitochondrial protein This correlates with an over-expression compared to native MDL1 of up to 100-fold To determine the localization of MDL1 in S cerevisiae, mitochondria of Dmdl1... interacts with the TOM receptor, responsible for the translocation of the preproteins to the translocase of the inner mitochondrial membrane (TIM)23 complex located in the IMM The presequence