three extensions to the inventory theoretic approach a transportation selection model a discrete event simulation of the inventory theoretic approach postponement from an inventory theoretic perspective
three extensions to the inventory theoretic approach- a transportation selection model, a discrete event simulation of the inventory theoretic approach, postponement from an inventory theoretic perspective
... speed and reliability of a door -to- door transportation move Speed and reliability are modeled by the mean and standard deviation of door -to- door transit time for all available transportation ... questions: what is the inventory theoretic approach and why use it? The inventory theoretic approach considers the trade-off between inventory and transportation in an effort to minimize total logistics ... handle a wide variety of variables, easily accommodate additional constraints, and guarantee the optimal answer given valid assumptions and accurate data In contrast to the matrix approach, which...
- 170
- 442
- 0
Báo cáo khoa học: "Contradictions and Justifications: Extensions to the Textual Entailment Task" ppt
... (DTO) AQUAINT program Thanks to fellow coordinators of the task, Chris Manning and Dan Moldovan, and to the participants for making the task possible References Ido Dagan, Oren Glickman, and ... Table The top half of the table shows the agreement between the two-way answer key and the annotations of the set of first judges; the bottom half is the same except using the annotations of the ... had the same score that would rank them second and third, they were each assigned rank 2.5.) A run was then assigned its mean rank over the 100 justifications Figure shows how the mean rank of...
- 9
- 376
- 0
introduction to discrete-event simulation and the simpy language
... to find the mean number of data packets in the system, as a product of the data arrival rate (given) and the mean residence time of data packets (computed in the simulation) The fact that data ... duration of this latest uptime period, and add it to our running total Again, make sure you understand why StartUpTime needs to be an instance variable rather than a class variable A point to always ... machines, so that we can eventually find out what proportion of the time the machines are up Be sure to make certain you understand why TotalUpTime must be a class variable rather than an instance...
- 33
- 1,871
- 0
báo cáo khoa học: " Benefits of global partnerships to facilitate access to medicines in developing countries: a multi-country analysis of patients and patient outcomes in GIPAP" pps
... data are sent from local GIPAP participating physicians to the central database quarterly The data are stored in the central system at TMF headquarters in Seattle All data are anonymous and are ... The sample includes the largest GIPAP participant (India), other large Asian countries (Pakistan, Thailand, Malaysia and China), countries with some health insurance coverage for small Page of ... cannot be certain about their status This is a limitation of the available data Overall, there does not appear to be any seasonal effect in the number of closed cases The patient-related data...
- 13
- 292
- 0
Discrete-Event Simulation: A First Course pot
... Simulation: A First Course Section 6.1: Discrete Random Variables 16/ 27 Discrete Random Variable Models A random variable is an abstract, but well defined, mathematical object A random variate is an algorithmically ... Simulation: A First Course Section 6.1: Discrete Random Variables 11/ 27 Expected Value The mean of a random variable is also known as the expected value The expected value of the discrete random variable ... variates in the next section Discrete- Event Simulation: A First Course Section 6.1: Discrete Random Variables 8/ 27 Mean and Standard Deviation The mean µ of the discrete random variable X is µ=...
- 27
- 456
- 0
discrete-event simulation a first course
... times, demand amounts, etc., the random number generator’s output can be converted to a random variate via an appropriate mathematical transformation The random variates are used to approximate some ... languages This is important because animation can increase the acceptance of discrete- event simulation as a legitimate problem-solving technique By using animation, dynamic graphical images can ... is appropriate Simulation Languages Simulation languages have built-in features that provide many of the tools needed to write a discrete- event simulation program Because of this, simulation languages...
- 538
- 1,188
- 0
A discrete dislocation study of thin film interfacial fracture
... source and obstacle distribution The red and blue solid lines indicate the top (metal) and bottom (substrate) sides of the metal-substrate interfacial crack (a) σ actual ~ +141MPa, and (b) σ actual ... right So, to all the system administrators, those whom I have spoken to directly, and all those whose work as a team keep the system up and running, a word of thanks and an admission that all this ... boundary conditions (such as the theory of Acharya and Bassani (2000)) does not predict the existence of boundary layers The same boundary problem may be analysed using the nonlocal crystal theory...
- 186
- 221
- 0
Model development for numerical simulation of the behaviors of ph stimulus responsive hydrogels
... becoming an alternative branch of research complementary to experiments and analytical theory It offers great deal of advantages, for instance, the freedom to control the parameters of the system and ... with available experimental data The simulations show a satisfactory agreement with the experiment data from open literature qualitatively and quantitatively The steady-state i behaviors of swelling ... (Ricka and Tanaka, 1984; Hooper et al., 1990; Basser and Grodzinsky, 1993) For instance, Ricka and Tanaka (1984) used the Donnan theory to model the swelling of weakly charged ionic gels The given...
- 267
- 369
- 0
A study on teaching oral skills to the first year students at Hanoi University of Industry in the Communicative Approach
... “knowledge-transmitter” They play the role of a facilitator of the students’ learning, a manager of classroom activities, an advisor to answer students’ questions and to control their performance, and a ... the information gap between the speaker and the hearer; making a choice from his repertoire of language of what to say and how to say it; and evaluating feedback from what he has done Information ... organizational aspects of language with the pragmatic • Language techniques are designed to engage learners in the pragmatic, authentic, functional use of language for meaningful purposes Organizational...
- 44
- 1,605
- 9
Tài liệu Understanding Potential Changes to the Veterans Equitable Resource Allocation (VERA) System - A Regression-Based Approach ppt
... qualitative analysis that formed the basis of Phase I of the study, and findings from the Phase II analysis Our analytic approach closely resembles the approach that we took in the Phase II analysis The ... with medical schools The goal of Phase II was to conduct a quantitative analysis aimed at evaluating the impact of a wide range of patient and facility characteristics on the variation in patient ... by RAND (Wasserman et al.) in January 2003 Again at the request of Congress, the VHA asked NDRI to conduct additional quantitative analyses to explore further the effects of patient and facility...
- 136
- 411
- 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the access and control ... (RRA) approach to initial project preparation was developed By the end of the decade, there was a range of RRA methods and approaches available which then gave rise to participatory rural appraisal ... in from a different area or family are disadvantaged, as they have to work their way in and probably have to learn the hard way, by learning from their mistakes The SLA embraces a wider approach...
- 95
- 645
- 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances were set to Da Up to two missed cleavages and half tryptic peptides were allowed The taxonomic search ... PAGE-based image analyses of the third quadrant Fig S3 2D IEF ⁄ SDS ⁄ PAGE-based image analyses of the fourth quadrant This supplementary material can be found in the online version of this article ... Kristiansen TZ, Jonnalagadda CK, Surendranath V, Niranjan V, Muthusamy B, Gandhi TK, Gronborg M et al (2003) Development of human protein reference database as an initial platform for approaching systems...
- 20
- 506
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... reappearance of any new signals was the result of Cu(I) to polypeptide stoichiometries higher than five Taken together, the initial additions of Cu(I) to each domain caused the disappearance of ... ordered to form a distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available ... disappearance of a large set of NOESY cross-peaks and the parallel appearance of another set of cross-peaks, until a clean 2D spectrum belonging to a single species was obtained Judging from the highest...
- 14
- 485
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE...
- 11
- 731
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... consists of the stream of segments and a stream of stressesS: pangupangu Lexical lookup is complicated due to the fact that the surface string can differ from the underlying representation of the ... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser...
- 8
- 522
- 0
Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf
... variable quantification to resolve pro-forms and VP ellipses to their antecedents The variable quantification in TLG is comparable to the use of memory in storing antecedents and anaphora The verbs ... in analytic languages by incorporating CCG with a memory mechanism In the memory mechanism, fillers and gaps are stored as modalities that modalize a syntactic category The fillers and the gaps are ... Hyderabad, India, January William A Woods 1970 Transition network grammars for natural language analysis Communications of the ACM, 13(10):591–606, October Gerald Gazdar 1988 Applicability of indexed...
- 9
- 572
- 0
Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt
... it, and (3) the most suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the ... signal is stored in GS and the tag t is placed in the normal position of the target T for final printout ILLUSTRATION As an example of the performance of this section of the program, we offer the text ... only As regards the second aim, the TCj which accompany a current word may reveal that it could be a possible indicator of a main clause, or subordinate clause, or a phrase If such is the case, an...
- 18
- 701
- 0
Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt
... pellet was discarded and a sample of the supernatant was withdrawn for radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which ... K data points was collected The spectrum was calibrated using a dataset of a sample of standard peptides After calibration, the masses of the standard peptides differed by maximum 1.1 p.p.m from ... was set to 2.2 A The cathode surface potential was )1 V and the anode potential was 10 V Both end-plate potentials of the ion trap were set at 1.5 V and the duration of the electron pulse was 100...
- 7
- 491
- 0
A Bayesian network approach to the database search problem in criminal proceedings docx
... runs a real risk to face a charge based on a ‘database hit’ For these reasons, questions that emanate from the use made of matches derived from database searches, as well as the assessment of their ... controversially, are approached in this article from a distinct perspective of a graphical approach As a principal aim, the discussion will focus on explaining how the use of a database impacts the value ... problem,’ ‘Bayesian network for a database search setting: suspect and one other individual in the database,’ ‘Bayesian network for a search of a database of size n > 2,’ and ‘Discussion and conclusions’...
- 17
- 458
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25