this secondary line is hooked and baited with squid fish or in cases we have discovered with fresh dolphin meat as quoted in what is a longline sea shepherd conservation society 2009 http www seashepherd org sharks longlining html accessed june 10 2009
báo cáo khoa học: " Patient- and delivery-level factors related to acceptance of HIV counseling and testing services among tuberculosis patients in South Africa: a qualitative study with " pdf
... thematic analysis [28] Two researchers and three research assistants conversant in both Sesotho and English performed thematic analysis by reading and rereading all the transcripts and developing ... program managers also pointed to a lack of appropriately trained staff members, as well as poor infrastructure to monitor and deliver HCT, as factors contributing to low acceptance rates among ... education, and communication materials provided in local languages, as well as concern about limited access to antiretroviral treatment: Posters that are in English are not easy to understand as it is...
- 10
- 407
- 0
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
... frontal sinus aplasia was defined as the absence of frontal bone pneumatization with no ethmoid cells extending above a line tangential to the supraorbital margin Frontal sinus aplasia was also ... (horizontal line) Frontal sinus aplasia is also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn through the middle of the orbit (vertical line) with a ... Asian Pac J Allergy Immunol 2006;24:123-7 Schaeffer J The Embryology, Development and Anatomy of the Nose, Paranasal Sinuses, Nasolacrimal Passageways and Olfactory Organs in Man Philadelphia:...
- 5
- 577
- 0
Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx
... nanoparticle characterization, DC loading and imaging and data analysis CO YZ participated in nanoparticle characterization, DC imaging and data analysis MO participated in nanoparticle characterization, ... the statistical analysis and manuscript preparation DM participated in nanoparticle characterization, DC loading and data analysis VK participated in data analysis and supervised studies related ... Cell lines T2 cell line [19] was purchased from ATCC (Manassas, VA) Human melanoma cell lines 624 and 1351, as well as human tumor-infiltrating lymphocytes (TIL) cell lines TIL1235 and TIL1520 were...
- 10
- 386
- 0
báo cáo hóa học:" Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" doc
... nanoparticle characterization, DC loading and imaging and data analysis CO YZ participated in nanoparticle characterization, DC imaging and data analysis MO participated in nanoparticle characterization, ... the statistical analysis and manuscript preparation DM participated in nanoparticle characterization, DC loading and data analysis VK participated in data analysis and supervised studies related ... Cell lines T2 cell line [19] was purchased from ATCC (Manassas, VA) Human melanoma cell lines 624 and 1351, as well as human tumor-infiltrating lymphocytes (TIL) cell lines TIL1235 and TIL1520 were...
- 10
- 375
- 0
Báo cáo y học: "Aerobic exercise and its impact on musculoskeletal pain in older adults: a 14 year prospective, longitudinal study" doc
... dance/exercises, stair steppers, brisk walking, hiking/treadmill, racket sports, and other Assessment of pain Annually since 1987, pain was assessed using a visual analog scale (VAS) where = no pain and 100 ... variables for smoking, and history of arthritis, fractures, and cancer at baseline Baseline values yt = 1987 were defined as weighted means [15], yt = yt + yt −1 ,t ∈ For all analyses, exercise ... significant covariates (p < 0.001) There were significant increases in pain scores for female and male community controls and runners with increasing age, although the rates of increase are relatively...
- 8
- 544
- 0
Báo cáo y học: "Municipal policies and plans of action aiming to promote physical activity and healthy eating habits among schoolchildren in Stockholm, Sweden: a cross-sectional study" potx
... any measures taken in order to increase walking and biking to school and in general? Significant measures taken = Yes, measures are taken to increase both walking and biking to school 14 11 Have ... clear and measurable aims Are there any plans of action aiming to promote physical activity and/ or healthy eating? Significant measures taken = Yes, AND the plan of action should be attached AND ... process is more complex and non-linear The linear approach is helpful in gathering and structuring data, although we must be careful with implications based on a presumed linear policy process Regarding...
- 11
- 378
- 0
Báo cáo y học: "Association between expatriation and HIV awareness and knowledge among injecting drug users in Kabul, Afghanistan: A cross-sectional comparison of former refugees to those remaining during conflict" ppsx
... paper is to examine whether displacement outside Afghanistan is associated with knowledge of HIV and other blood-borne infections among IDU in Kabul, Afghanistan This information is important because ... it indicates the penetration of HIV awareness and harm reduction programming in both Afghanistan and in neighboring countries within this high risk and potentially marginalized group and the accuracy ... prevention is pertinent for Afghanistan due to factors that may result in a concentrated epidemic among injecting drug users (IDU) Iran, Pakistan, Uzbekistan, Tajikistan, and western China are all experiencing...
- 8
- 233
- 0
Báo cáo y học: "Misdiagnosis and undiagnosis due to pattern similarity in Chinese medicine: a stochastic simulation study using pattern differentiation algorithm" pdf
... simulated for each ZFSP and grouped the manifestations present at least once among the simulated cases into a temporary dataset After comparison with the original MPSA dataset, the algorithm reported ... regarding both treatment and prognosis are intrinsically worse in this particular order Thus, two ordinal measures of association were used to evaluate whether there was monotonic linear relations ... Pattern differentiation outcomes (correct, misdiagnosis and undiagnosis) were categorized for analysis of association with pattern similarity and the Four Examinations Four Examinations and pattern...
- 13
- 272
- 0
Báo cáo y học: "Preadmission statin use and one-year mortality among patients in intensive care - A cohort study" pdf
... diabetes; cardiovascular diseases; respiratory diseases; gastrointestinal and liver diseases; cancer; trauma and poisoning; and others (for details on International Classification of Diseases (ICD) ... hydrophilic atorvastatin and pravastatin and used Wald statistics to compute P values for the difference in MRR between types of statins To assess possible unmeasured confounding by indication for statin ... and patients undergoing organ transplantation Intensive care data ICU patients were identified using a research database (Aarhus University Intensive Care Cohort (AUICC)) Data on use of mechanical...
- 10
- 311
- 0
Báo cáo y học: "Preadmission beta-blocker use and 30-day mortality among patients in intensive care: a cohort study" pps
... diabetes); cardiovascular diseases; respiratory diseases; gastrointestinal and liver diseases; cancer; trauma and poisoning; and others We classified patients as ‘medical’ or ‘surgical’ according to ... confounding Beta-blockers are prescribed for cardiovascular diseases that may be associated with increased mortality in ICU patients Confounding arising from underlying cardiovascular diseases, ... confounding We lacked data on severity of illness, such as SAPS, SOFA, or APACHE scores; however, laboratory data as well as use of vasopressors and inotropics was virtually the same among beta-blocker...
- 8
- 285
- 0
Báo cáo y học: "Line bisection performance in patients with generalized anxiety disorder and treatment-resistant depressionLine bisection performance in patients with generalized anxiety disorder and treatment-resistant depression"
... of the line Data analyses and statistics There are many classical methods to analyze line bisection performance, for instance the percentage expression of bias errors 35 Here we employed a me- ... plausible explanation for the paradox As aforementioned, a rightward bias has been reported in healthy subjects in some Eastern countries like Japan and China, contradictory to those found in Western ... frontal EEG asymmetry at rest is related to a tendency to engage in sensation-seeking and risky behaviors in young adults 23 Likewise, the association of left hemisphere predominance and risk-taking...
- 8
- 572
- 0
Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.
... download time is faster than Java, and also you don't have to worry about integrating different languages into the page, as Curl is capable of providing the same features as both Java and JavaScript ... JSP is also very powerful, faster than ASP, and instantly familiar to Java programmers It allows the Java program to leverage the aspects of the Java2 platform such as JavaBeans and the Java libraries ... can think of this as a giant toolkit for creating all sorts of applications, and in particular, for creating applications on the Web When we come to install ASP.NET, we will also be installing...
- 792
- 596
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... damaged 4940 Materials Crystalline AdoCbl was a gift from Eisai (Tokyo, Japan) CN-Cbl was obtained from Glaxo Research Laboratories (Greenford, UK) AdePeCbl was synthesized according to published ... Hsc70 and ADP as well The residue corresponding to Glua459 of the DD reactivase is Alaa461 in glycerol dehydratase reactivase Furthermore, 2¢-dATP retained half of the efficacy of ATP in the activation ... factors – that is, subunit swapping might occur However, no biochemical evidence for this has been obtained so far A similar reactivating factor for ethanolamine ammonia lyase has been reported...
- 13
- 620
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT...
- 14
- 517
- 0
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
... Takahashi N (2004) Human fibrillarin forms a sub-complex with splicing factor 2-associated p32, protein arginine methyltransferases, and tubulins alpha and beta that is independent of its association ... on SDS ⁄ PAGE After fixing the gel for 20 in 10% v ⁄ v both methanol and acetic acid in water it was washed, and incubated in amplifying solution (GE Healthcare) for h 30 min, washed again briefly, ... domain Recombinant plasmids were transfected in Saccharomyces cerevisiae strain L40 A human fetal brain cDNA library (Clontech, Palo Alto, CA) expressing GAL4 activation domain (AD) fusion proteins...
- 16
- 367
- 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
... EmbR was run on SDS ⁄ PAGE and its phosphorylation was visualized by autoradiography (B) Phosphorylation of EmbR by PknA and PknB (a) In vitro kinase assays were performed to examine the ability ... as described previously [32] ATPase activity was also determined, as described previously, by a filter binding assay [32] Gel mobility shift assay The protein–DNA binding assay was performed as ... ATPase and GTPase activities, with ATP preferred over GTP as a substrate (Fig 2B) No phosphate was released when ADP was used as a substrate, indicating A ATP that EmbR is not a phosphatase These...
- 11
- 402
- 0
Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc
... 5¢-GGTGGTA GATGATCGGCAAGGTTTGC-3¢), C130S (forward 5¢CCAATTGGTGTGCTAAAGACTTTG-3¢/reverse 5¢-AA GGATAAATATGTGAGAAGATATTC-3¢), C133 (forward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/ reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), ... 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C159S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C176S (forward 5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- 3¢/reverse 5¢-TCAAATTTGG GCTTCCTCAATTTC-3¢) ... taking advantage of the His-tag In contrast to earlier activity measurements, sulfhydryl oxidase activity was measured with dithiothreitol, which was a good substrate in NaCl/Pi ([21] and Material...
- 8
- 405
- 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
... and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes and 10, B oleracea var italica The amount of protein applied was lg for A thaliana and 40 lg for the ... plasma membrane in vivo and in vitro Almost all PCaP1 was associated with the membrane and was not released by treatment with a high concentration of salt or urea (Fig 3) Alkaline treatment with ... enzymes, namely methionine aminopeptidase (MAP) and myristoyl-CoA:protein N-myristoyltransferase (NMT) Three MAP isoforms, MAP 1A, MAP 2A and MAP2B, have been identified in A thaliana as the cytoplasmic...
- 16
- 424
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25