there was an opening deposit and a subsequent withdrawal of the same amount prior to the qualifying period for interest accrual this account usage is labeled an in and out account
báo cáo khoa học: "A rare combination of an endocrine tumour of the common bile duct and a follicular lymphoma of the ampulla of Vater: a case report and review of the literature" ppt
... revised the manuscript for submission VSt participated in drafting and revising the manuscript AT participated in gathering the data and drafted the manuscript EK performed the appropriate histological ... histological differentiation, Ki-67 immunostaining, invasion of adjacent tissues, and vascular and perineural invasion Available data extrapolated from the existing literature suggest that carcinoid ... obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Author details...
- 4
- 427
- 0
Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
... NADP+ can arise If we assume the use of a commercial NADP+ containing 0.3% NAD+, as in the case of the Roche sample used in this study, then in a steady-state assay, as in the rapid-reaction ... identity of the contaminant Comparison with the spectrum of an authentic NAD+ sample revealed total similarity of the fragmentation pattern The negative portion of the spectrum displayed a fragment at ... (concentrations after mixing) monitored at 340 nm over 250 The increase in absorbance was linear for the rst 3040 min; on this basis, the value for the specic activity was calculated as 1.84 nmolặmin)1ặmg)1,...
- 9
- 526
- 0
CORREGGIO A COLLECTION OF FIFTEEN PICTURES AND A SUPPOSED PORTRAIT OF THE PAINTER, WITH INTRODUCTION AND INTERPRETATION pot
... into the land of Israel; for they are dead which sought[50] the young child's life And he arose, and took the young child and his mother, and came into the land of Israel."[21] [21] The quotations ... a journey which at that time was long and tedious An angel appeared to Joseph one night in a dream, saying, "Arise, and take the young child and his mother, and flee into Egypt, and be thou there ... Greek, and his most valuable work was his translations He rendered into Latin, which was the literary language of his day, the various books of the Old and New Testament, and this version became the...
- 87
- 566
- 0
Báo cáo khoa học: " SemiIntensity modulated radiotherapy (IMRT) in benign giant cell tumors – a single institution case series and a short review of the literatur" docx
... FZ and CTH participated in data acquisition and literature review MB, JD and PEH participated in drafting the manuscript and revised it critically All authors read and approved the final manuscript ... Considering the radiographic outcome of giant cell tumors after radiotherapy, the available information in the literature is even more scanty than for clinical outcome This may be linked to the use of ... term toxicity with this promising approach exists so far and therefore further investigation is needed to establish the value of this treatment option Therefore primary radiotherapy has to be...
- 7
- 379
- 0
Báo cáo y học: "Mitral valve surgery for mitral regurgitation caused by Libman-Sacks endocarditis: a report of four cases and a systematic review of the literature" pptx
... prednisone, plaquenil and azathioprine On routine examination in 2006 the patient appeared to have a blowing systolic murmur at the apex radiating to the left axilla Transthoracic echocardiography ... diagnosis was papillary fibroelastoma Laboratory findings are shown in Table The patient was diagnosed with primary APS Subsequently, LS endocarditis of the mitral valve was considered as an alternative ... Page of 13 Figure Microscopic histopathological examination of excised mitral valve tissue in patient (A, B), (C,D), and (E,F) (A) Photomicrograph of patient Haematoxylin and Eosin (HE) stain of...
- 13
- 584
- 0
Báo cáo y học: " Arterial embolization of an extrapleural hematoma from a dislocated fracture of the lumbar spine: a case report" potx
... accumulated in the thoracic cavity was because of an EH and not because of the hemothorax An angiography was immediately performed to restore hemostasis; a shepherd-hook catheter (4 F, CX catheter A2 ; ... procedure of AE was completed in 30 minutes The EH reduced in size after AE, and Figure vertebral and retroperitoneal hematomas (a) Initial computed tomography (axial image:left); This CT scan shows a ... epidural hematomas of the head) However, this typical D-shaped opacity was not initially seen in our patient The basis for our diagnosis of EH was as follows: (1) initial radiological examination...
- 5
- 199
- 0
A position statement of the National Association for the Education of Young Children docx
... Representational modes and media also vary with the age of the child For instance, most learning for infants and toddlers is sensory and motoric, but by age children use one object to stand for another ... programs are encouraged and supported to obtain and maintain, through study and participation in inservice training, current knowledge of child development and learning and its application to early ... Furthermore, each of these dimensions of knowledge—human development and learning, individual characteristics and experiences, and social and cultural contexts is dynamic and changing, requiring that early...
- 22
- 1,000
- 0
So, you want to go to grad school in Economics? A practical guide of the first years (for outsiders) from insiders pptx
... this way you can work together and learn the material together, and take advantage of comparative skills Remember: The important thing is to learn, not to finish the race in time for the next problem ... career It is the most demanding part of it, and you need to be ready to have the energy to cope up with the program’s demands There are certain things (truths, half-truths, lies, and urban legends) ... have a competitive knowledge of calculus and linear algebra Familiarity with statistics is also welcome The ideal is to have knowledge of real analysis and some concepts of measure theory The...
- 12
- 696
- 0
A position paper of the EPS Energy for the Future phần 1 ppt
... growth of Asian and Latin American countries, and the just aspirations of developing countries for reasonable standards of living all point inescapably to the need for sustainable energy sources The ... plants this includes the handling and storage of spent fuel and, in the case of coal or oil fired plants, the retention of sulphur dioxide (SO2), unburnt carbon, and in an ideal case the storage of ... carried out the analysis Climate change Since the beginning of industrialisation the world has experienced a rise in average temperature which is almost certainly due to the man-made amplification of...
- 10
- 575
- 0
A position paper of the EPS Energy for the Future phần 2 ppt
... Asia and Middle East is rather different: there are 90 reactors in operation and a significant expansion is foreseen, especially in China, India, Japan, and the Republic of Korea [19] Nuclear power ... phenomenon of spontaneous disintegration or transformation of an atomic nucleus into another, accompanied by the emission of alpha, beta or gamma radiation, referred to collectively as ionising radiation ... Further advantages of this mode of operation can be found in [47] The major disadvantage of this process is that it produces radioactive waste that has to be stored for hundreds of thousands of...
- 10
- 434
- 0
A position paper of the EPS Energy for the Future phần 3 potx
... important step towards its realisation was taken by the decision to build the International Thermonuclear Experimental Reactor, ITER, [55] in Cadarache, France In this reactor deuterium and tritium ... appreciate and judge technological risks and risk assessments in an industrialised economy Great efforts are needed to inform the general public of the short-term and long-term safety aspects and the ... There is a clear need for long-term research, development and demonstration programmes as well as basic research into both nuclear fission and fusion and methods of waste transmutation and storage...
- 10
- 611
- 0
báo cáo khoa học: " A Guide for applying a revised version of the PARIHS framework for implementation" pdf
... defined and acknowledged Appropriate & transparent decision making processes Power and authority processes Resources – human, financial, equipment – allocated and Information and feedback Initiative ... for diagnostic analysis and planning • Observations and tips: This additional information, from the implementation literature and authors’ experiences, is designed to enhance researchers’ nuanced ... observations about use of elements/subelements, and a set of questions for diagnostic analysis and planning All of the separate components of the actual Guide are contained in additional files (see Additional...
- 10
- 458
- 0
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... acquisition and analysis of data and participated in drafting and editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised ... supervised the drafting and editing of manuscript All authors reviewed and revised drafts of the manuscript All authors read and approved the final manuscript 18 Ethics approval The study was approved ... is conducted and how results are being achieved The lack of a standard approach to assessing PA programmes for the elderly makes it difficult to compare the quality of both the planning and the...
- 30
- 369
- 0
A Preliminary Evaluation of the English Course for Academic Purposes at the International Department, Thai Nguyen University = Đánh giá sơ bộ khóa học tiếng Anh
... evaluation pave the way for teaching staff of each organization and policy makers to have the ability to discriminate amongst all the available books in the market and considering weak, as well as ... distinguished EGAP and ESAP as follows: „EGAP refers to the teaching of the skills and language that are common to all disciplines; ESAP refers to the teaching of the features that distinguish ... data collected and interpretations are made with an attempt to answer the research questions 20 CHAPTER 3: DATA ANALYSIS AND DISCUSSION This chapter presents and discusses the findings that arise...
- 53
- 909
- 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... nancial support from the EXTRA programme of UNIMIB-Cariplo, allowing her to carry out part of this work in Marseille The authors wish to thank Antonino Natalello and Silvia Maria Doglia for their ... because isolated NTAIL is less extended than isolated PNT The structural disorder and exibility typical of isolated NTAIL is maintained and appears to increase in the fusion, resulting in a Stokes ... 20 of tryptic digestion (Fig 8B, band c) was found to span the same amino acid sequence as the band of the same size that was detectable after of digestion of PNT alone (Fig 8B, band d) This...
- 14
- 672
- 0
Andersen’s Fairy TalesBy Hans Christian Andersen.THE EMPEROR’S NEW CLOTHESMany years ago, there was an Emperor, who was so excessively fond of new clothes, that he spent all his money in dress. He did not trouble himself in the least about his sold pdf
... principal person in the procession was a priest Astonished at what he saw, the Councillor asked what was the meaning of all this mummery, and who that man was ‘That’s the Bishop of Zealand,’ was ... beating the white of an egg in a glass Of water The matter of which it was built was just as soft, and formed similar towers, and domes, and pillars, transparent and rocking in the thin air; ... the same as the half of the shattered die of Fortune This the lieutenant felt most poignantly, and this was the reason he leant his head against the window, and sighed so deeply Free eBooks at...
- 200
- 469
- 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... Komolpith U, Ramakrishnan N: Bioassay of the nuclear polyhedrosis virus against larval stages of Spodoptera litura (Fab) and the effect of protectants against ultraviolet light Proc Indian Acad Sci ... with S litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850, respectively) and 85% with S exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823; AY127899 and AJ277555,...
- 11
- 854
- 0
Báo cáo hóa học: " A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting" pptx
... execute the neonatal transfers Therefore, ambulances avoided wasting time in an attempt to locate a neonatal ventilator or working incubator The allocation of a dedicated ambulance ensured that vehicle ... Centre for every call received and processed in Data analysis Response times, transit times and mission times for all maternal and neonatal transfers were examined to establish performance in the ... using the time in minutes for each of the individual observations and then calculating the mean This was reported for each of the different status modes: times to dispatch’ and to scene’, as...
- 6
- 432
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
... s-1) Aluminium, stomata and photosynthesis in beech of both chl a and chl b concentrations was recorded in the leaves of +Al, –CaMg and +Al–CaMg plants to about 40% of the control values The ratio ... between +Al (–31%) and –CaMg (–43%) treatments An interaction between excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy ... vitality via a disturbance in stomatal regulation and leaf carbon assimilation In beech seedlings exposed to aluminium, Al accumulated in the parenchyma, and palisade cells always showed higher Al concentration...
- 10
- 376
- 0
báo cáo khoa học: " Science, institutional archives and open access: an overview and a pilot survey on the Italian cancer research institutions" ppt
... for Cancer Information Standardized metadata for aggregating Italian biomedical publications Repositories contain metadata, say “meta information” (data about data) They can be defined as structured ... describing an item in a standardized Page of 14 format According to Ed Simons “Metadata allow us to describe and classify research information in a systematic way, and as such they are indispensable for ... been translated into many languages and have become an international standard for indexing biomedical literature The Italian MeSH translation, carried on by the Istituto Superiore di Sanità, is freely...
- 14
- 297
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25