the structure of human interferon β 1a avonex® and its relation to activity a case study of the use of structural data in the arena of protein pharmaceuticals
... reaxrange the boundaries given by the syntax when the intonational phrasing of an utterance does not correspond toits syntactic phrasing (so-called "bracketing paradoxes") In this case, boundaries ... when the ATM computation halts and accepts If, on the other hand, the surface form contains any nonhalting or nonaccepting units, then the ATM does not accept its input w in polynomial time The ... a rule R,~_, at the end ofthe cycle that adds an extra boundary symbol to each end ofthe derivation string, unless the simulated machine has halted The remaining details are omitted, but may...
... such variables inthe diagnosis and management of pain should endeavour to measure variables ofthe stress response to support rhetoric that their management approaches can manage chronic pain and ... explain some ofthe clinical observations being made and recorded inthe journals A review by Siegrist and Marmot discusses psychosocial variables as causative, aggravating, and perpetuating factors ... T, Krukoff TL, Jhamandas JH: Branching projections of catecholaminergic brainstem neurons tothe paraventricular hypothalamic nucleus andthe central nucleus ofthe amygdala inthe rat Brain Res...
... including search functionality was developed, using the Java programming language Determination of reading frames The reading frame ofa cDNA insert was determined using the following formula: ... resistance to 15 µg/ml kanamycin and carries the lacIQ repressor andthe argU gene for the arginine tRNA that recognizes the rare codons AGG and AGA The low abundance of this tRNA is especially ... ORF start position in Ensembl depends on experimental data from other databases and is not determined automatically Many transcript sequences inthe Ensembl database were generated automatically...
... conjectured that, for any oriented graph G, a minimum oriented cut in G has cardinality equal tothe maximum cardinality ofa family of pairwise disjoint transversals of oriented cuts Woodall’s conjecture ... more than one third ofits arcs Hence, the oriented girth of T is larger than the maximum cardinality ofa family of pairwise disjoint transversals and, therefore, T is a counterexample to this ... cycles of G A dual version of Woodall’s conjecture may be stated as follows: for any planar oriented graph G, the oriented girth of G is equal tothe maximum cardinality ofa family of pairwise...
... perpendicular tothe grain (radial and tangential) is much lower than parallel tothe grain (longitudinal) The presence of different types of bonds, strong and stiff bonds along the chain axis and weak and ... required to cause static failure [55] According to Winandy and Rowell [55] repeated or fatiguetype stresses usually result ina slow thermal build-up within the material and initiate and propagate tiny ... level); and fiber -to- fiber bonding with the middle lamella acting as the adhesive (macroscopic level) According to Sweet and Winandy [45] wood fibres can be regarded as a composite material anda single...
... involved the gastrointestinal tract [1,2] Only one out of six extramedullary relapses reported by a North American Institution involved the gastrointestinal tract [3] All of these cases had a poor ... with a maximal survival rate of 106 days from diagnosis Finally, Dawson et al reported thecaseofa 60-year-old patient with MM with hematemesis, melena and gastroduodenal mucosal lesions [4] The ... the management ofthe patient PRB wrote the manuscript with support from TAM and PYD TAM and XM reviewed and interpreted the pathology slides and CT scan images, respectively All authors read and...
... 1997:192) Acasestudy consists of three stages which are data input (data presented through texts, audio and video recordings), data processing (understanding and manipulating data) and output ... any inconsistence between teachers’ beliefs and practices Finally, thedata was gathered and analyzed to disclose the main findings and answer the research questions 1.6 Significance ofthestudy ... researcher used to conduct thestudyThe next chapter will focus on data analysis and findings 22 CHAPTER THREE: DATA ANALYSIS AND FINDINGS 3.1 Interview The transcript data collected in four interviews...
... Atmospheric-Ocean Global Circulation Models, are used to assess climate change impacts in Lao Cai Province, namely: Baseline scenario using the historical dataand simulating the climate during ... from the investor andthe provincial and local authorities must be ensured; (4) Adherence tothe policy relating to land clearance approved by the government andthe People’s Committee of Lao Cai ... (targeted and others), andto assess the overall result anticipated by each ofthe main transmission channels which are: prices, employment, transfers, access, authority and assets Important aspects of...
... breastfed andthe duration of breastfeeding, preventative and curative medical care, andthe quantity and quality of time ofthe mother or others in care-related activities The quality of child care ... basic humanand labor rights; inthe standard taxonomy the former would instead be classified as ‘cash standards’.47 Above it was noted that financing childcare and other family services out of tax ... cognitive ability and schooling attainment, they calculate benefit to cost ratios inthe range of 2.4 to 3.1, depending on the assumptions used about impacts As Van der Gaag and Tan note, these ratios...
... values for total energy, total fat, saturated fat, cholesterol, and sugars; and users ofthe health claims had lower reported values for total fat and saturated fat Reported dietary fiber intake ... Covariates onlyc Useof Nutrition Facts panelc Useof list of ingredientsc Useof serving sizec Useof health claimsc Useof total fat informationde Saturated fat intake (g/d) Covariates onlyc Use ... ***PϽ0.001 for total energy, total fat, saturated fat, and sugars; users ofthe list of ingredients had lower reported values for total fat, saturated fat, and sodium; users ofthe serving size had lower...
... macrovascular disease andthe severity of SSc This might explain the absence of increased levels of endothelial activation markers All these data point tothe absence of premature atherosclerosis in ... immunosuppressive agents Markers of inflammation, such as CRP, are related tothe risk of cardiovascular and peripheral vascular disease Increased levels of CRP are associated with increased risk of symptomatic ... been performed inthe last decade using IMT ofthe carotid artery as a marker of early atherosclerosis Lekakis and colleagues [22], Kaloudi and colleagues [23], and Bartoli and colleagues [24,25]...
... non-survivors indicating a strong relation between acidic reflux and high mortality rate in VAP patients Acid and pepsin are the major factors responsible for symptoms and esophageal mucosal damage in gastroesophageal ... duration of PICU stay, setting of mechanical ventilation, history of medications, type of nutrition andthe fate of all patients Full clinical examination and estimation ofthe angle of back ... with the total mortality in 2007 being 30% The overall rate of mechanical ventilation inthe same year was 70% with half of these patients developing VAP The mortality among the VAP patients was...
... listening skills Including talking to learners inthe target language, raising learners' awareness of their listening styles and strategies and introducing a range of materials, speaking styles and ... listening as a process of receiving what the speaker actually says, constructing and representing meaning, negotiating meaning with the speaker and responding, and creating meaning through involvement, ... give a clear lead in what they are going to hear; use some kinds of visual back up for them to understand; give questions and tasks in order to clarify the things in their minds; and be sure that...
... Exposure Factor average of daily solar radiation average of solar radiation maximum ofthe day average of daily solar radiation total Storey height Staggering of Blocks Arrangement Screening Tool ... plot ratio and gross floor area Inthe face of rapid urbanization, the relationship between building density and urban form has attracted wide interest Martin and March analyze the relationship ... far the urban texture and micro-climatic condition are affecting each other, andthe possibility to transform this relationship into a practical analysis approach for urban performance evaluation...
... years of training and provide a range of medical services, including diagnosis and treatment, surgery and anaesthesia, and mending fractures They form the cornerstone of hospital care in many ... EHRP to increasing the availability of staff for the expanding ART programme both in total andin underserved areas This is consistent with the growing acknowledgement that the basic human infrastructure ... getting contracts and payment due to administrative delays One problem was that the promised 52% salary top-up was not translated into a 52% increase in take-home pay because of changes tothe tax...
... arms ofa trial of interferon- β- 1ain patients with rheumatoid arthritisa Response, according to ACR criteria, of subjects ina trial ofβ interferon- β- 1ain patients with rheumatoid arthritis Adverse ... http://arthritis-research.com/content/6/1/R73 Table β Baseline characteristics of subjects in placebo and active-drug arms ofa trial of interferon- β- 1ain patients with rheumatoid arthritis Characteristic Mean age ... terminating thestudy before week 24, only two inthe IFN -β- 1a arm and one inthe placebo arm left thestudy secondary to adverse events The majority of patients Available online http://arthritis-research.com/content/6/1/R73...
... related tothestudy : Communicative approach to language teaching, and pairwork and groupwork in language teaching and learning 1.1 Communicative approach to language teaching 1.1.1 What is meant ... Hanoi teachers’ training University Inthe past, most of these teachers mainly used the GrammarTranslation Method - a way of teaching and learning a foreign language on the basis of detailed analysis ... working in pair and group According to Adrian Doff, students can practise language together, studya text, research language or take part in information- gap activities in pairwork They also can...
... latrines and hand pumps which were installed at the beginning ofthe establishment of Bauniabad area The main activities included; (i) a baseline and needs assessment survey, (ii) training of ... sources and practices about drinking water, types of latrines, cost and financial aspects, local community participation, hygiene practices, and other water and sanitation issues Participatory data ... biogas plant tothe Plan International, because people came to know the benefit of having the connection of their latrines to biogas plants At the installation, the community agreed to share the...
... (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ inthe laboratory-scale andthe full-scale activated sludge were quantified ... DNA extracted from activated sludge were evaluated In addition, the amount of Candidatus ‘Accumulibacter phosphatis’ in laboratory-scale EBPR and full-scale activated sludge samples were quantified...
... university campus feed the main pumping station at the entrance ofthe treatment plant At the main pumping station, solid materials such as papers, glass, etc are removed by a screen The sewage is then ... collected and analysed to determine the quality ofthe sewage The main component of interest was the Total Volatile Solids (TVS) present in sewage which would establish the component ofthe sewage that ... objective ofthestudy is to determine the biogas potential ofthe sewage at the Primary Sedimentation Tank (PST) at the KNUST sewage treatment plant andits potential power production Feedstock analysis...