the musician s brain as a model for adaptive and maladaptive plasticity eckart altenmüller
báo cáo hóa học: " Impact of gastroesophageal reflux disease on work absenteeism, presenteeism and productivity in daily life: a European observational study" doc
... from Janssen, AstraZeneca and Falk (Galenica); JH has received speaker fees from AstraZeneca; LA has received research grants and speaker fees from AstraZeneca, and is a former advisory board member ... preparation Data analysis was provided by AstraZeneca All authors read and approved the final submission Acknowledgements This study was supported by AstraZeneca We thank Anna Mett and Claire Byrne, ... productivity and associated costs (this may explain why productivity impairment was not as marked as for other chronic diseases, as discussed above) Further investigation of the differences in productivity...
- 7
- 410
- 0
báo cáo hóa học:" Organization and exploration of heterogeneous personal data collected in daily life" pptx
... is a candidate for a landmark A tag that has rarely been used during a long period of time is also a candidate for a landmark Outliers are candidates for landmarks in time-series data, such as ... related information and events A summary contains several landmarks Of course, summaries and landmarks change depending on viewpoints and their scale This paper proposes six main landmarks • Landmark ... logs have attributes of places in a schedule and on a calendar They are assigned by the name of the places, and the addresses or names of shops Occasionally, places indicate homes, offices, stations,...
- 29
- 323
- 0
Báo cáo hóa học: "Organization and exploration of heterogeneous personal data collected in daily life" ppt
... is a candidate for a landmark A tag that has rarely been used during a long period of time is also a candidate for a landmark Outliers are candidates for landmarks in time-series data, such as ... related information and events A summary contains several landmarks Of course, summaries and landmarks change depending on viewpoints and their scale This paper proposes six main landmarks • Landmark ... logs have attributes of places in a schedule and on a calendar They are assigned by the name of the places, and the addresses or names of shops Occasionally, places indicate homes, offices, stations,...
- 29
- 373
- 0
How to Free Yourself of ANY Disease, Stop Fatigue, And Create Unstoppable Energy in Your Life.
... lives that creates the confusion, the sickness and the disease Most doctors are trained to look for the “cause” of the disease, to look for the viruses, to kill the viruses, the bacteria and the ... germs This is as futile as trying to kill all the rats in a trash infested city Lets take the United States as a bench-mark for an example If the above backwards healing philosophy of treating SYMPTOMS ... this is how almost everyone approaches their health these days! We’re all looking for the Germs, the VIRUSES, the “rats” which are the cause of disease and sickness The reality of it is, the...
- 20
- 541
- 1
![physics in daily life [coll. of newspaper columns from europhysics news] - j. hermans (edp, 2012) ww](https://media.store123doc.com/images/document/14/y/or/small_orn1399113492.jpg)
physics in daily life [coll. of newspaper columns from europhysics news] - j. hermans (edp, 2012) ww
... deformed like small pancakes, and have a flat bottom Consequently, their frontal area is larger than for spherical droplets having the same mass As a result of the increased drag, the terminal ... European journals and ‘features’ In addition there has been, for the past decade, a page entitled ‘Physics in Daily Life’ The present volume is a collection of these pages and is a feast of erudition ... decoration taste as long as we stay away from Aluminium paint and the like What happened to the detailed balance argument? Obviously, detailed balance holds, but we have to consider one and the same...
- 113
- 240
- 0
teaching and learning communication skills in social work education
... with learning disabilities and with language disadvantages.” Assessment of learning As noted above, the module is assessed by the service users The grading is a percentage mark, based on the service ... requirements for the degree courses The national occupational standards for social work (TOPSS, 200213) and the Benchmark statement for social work (QAA, 200214) form the basis for the assessment ... as well as the classroom Inviting users and carers to become part of the learning and assessment of student communication skills in practice settings has very obvious benefits Service users and...
- 84
- 638
- 0
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... tools used, parameter values, and output datasets Galaxy groups a series of analysis steps into a history, and users can create, copy, and version histories All datasets in a history - initial, ... history panel shows data and the results of analyses performed by the user, as well as automatically tracked metadata and user-generated annotations Every action by the user generates a new history ... computational analyses, systematically repeating analyses, capturing all details of performed analyses, and annotating analyses Using Galaxy Pages, researchers can communicate all components of an...
- 13
- 400
- 0
typical cultural features found in daily life of the community in the series little house on the prairie by laura ingalls wilder from the perspectives of language – culture
... mother 's and father 's positions From the beginning, she was affected by her father s story and the assumption that the Indian as wild as the wild animals It s when she reasoned ―Pa knew all about ... Americans During the research, some linguistic expressions of these features are also demonstrated based o statistics and analyses 3.2 Implications of the Study With discussions and investigations ... capitalism and the rationallegal nation-state He emphasizes the importance of cultural influences embedded in religion as a means for understanding the genesis of capitalism and the success of the USA...
- 52
- 358
- 0
Báo cáo khoa học: "The role of Bcl-xL and nuclear factor-kB in the effect of taxol on the viability of dendritic cells" ppsx
... K, Tasaki A, Yamanaka N, Nakashima H, Kuroki H, Nakamura K, Nakamura M, Katano M Paclitaxel probably enhances cytotoxicity of natural killer cells against breast carcinoma cells by increasing ... inhibitor assay, the percentage of viable DCs was measured as described in Fig (B) Asterisk (*) and sharp (#) indicate p ＜ 0.05 in the comparison of ContDCs vs TaxolDCs, TaxolDCs vs TaxolDCs + N-p-tosyl-L-phenylalanine ... Logan D, Mackay JA, Evans WK Lung Cancer Disease Site Group of Cancer Care Ontario s Program in Evidence-based Care Taxanes as first-line therapy for advanced non-small cell lung cancer: a systemic...
- 5
- 335
- 0
The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock
... the loss of vascular homeostasis in sepsis The normal balance between vasodilator (e.g NO, vasodilating prostaglandins) and vasoconstricting influences (e.g catecholamines, angiotensin II, platelet ... putrefaction) Pepsis was good, embodying the natural processes of maturation and fermentation while sepsis was bad and synonymous with putrefaction as characterised by bad smell It was only thousands ... THE ROLE OF NITRIC OXIDE AND OTHER GASEOUS MEDIATORS IN CARDIOVASCULAR DISEASE MODELS: EMPHASIS ON SEPTIC SHOCK FARHANA ANUAR B.Sc.(Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF...
- 222
- 297
- 0
Pompe disease in children and adults: natural course, disease severity and impact on daily life docx
... such as a patient with two deleterious mutations and undetectable acid α-glucosidase activity in fibroblasts, who would have been classified as a classic infantile case of Pompe disease based ... of additional preclinical or clinical studies or additional data gathered by post-marketing surveillance.112 Clinical databases for rare diseases Clinical databases or disease registries are ... α-glucosidase.54 A second method calculates the ratio between the activity of neutral maltases and the combined activities of acid α-glucosidase and residual maltase-glucoamylase in the presence of maltose...
- 206
- 443
- 0
báo cáo hóa học:" Physicians'''' knowledge of health-related quality of life and perception of its importance in daily clinical practice" pot
... those held by the patients and QoL assessment should be performed by the patients themselves using adequate and valid measures or, in alternative, by someone who acts as a proxy or surrogate, such ... and quantitative information The majority said that QoL was interesting and important Users had seen more information and scales, and were more aware of their use; only 8% had ever used formal ... QoL assessment in oncology but that most tended to rely on a physician-base assessment rather than patient-based instruments [8] In 1998, a survey of family physicians reported that for 78% of them...
- 7
- 306
- 0
Báo cáo y học: " Efficacy, safety and pharmacokinetic of once-daily boosted saquinavir (1500/100 mg) together with 2 nucleos(t)ide reverse transcriptase inhibitors in real life: a multicentre prospective study" ppt
... variables were assessed by the chi-square test for qualitative variables and by the Spearman s rank-correlation coefficients for quantitative variables The variables tested by univariate analysis ... with and without chronic hepatitis and/ or cirrhosis, only (0.6%) and 13 cases (5.4%), respectively, developed grade 3-4 transaminase increases Moreover, none of these cases was symptomatic, and the ... inclusion was censored in May 2007 to allow a minimum of 12 months of follow-up Follow-up, assessments and endpoints Patients’ assessment was performed at baseline, after the first month on treatment...
- 9
- 326
- 0
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school
... in the thesis, the researcher wants to find out the attitudes, as well as the cultural awareness in teaching and learning spoken English of the teachers and the students of 10 th grade at NTT school; ... responsible for making themselves understandable to listeners through selected and adapted messages based on listeners’ understanding feedback This means that speakers use devices in order to facilitate ... producing and interpreting the target languages because they will transfer from their own language Students may use Vietnamese codes to speak and sometimes they translate on a word-by-words basis They...
- 38
- 1,225
- 0
HOW TO IMPROVE LISTENING SKILLS IN TOEIC THE CASE OF questions and responses short conversations
... difficulties for the student, specially, the case of: Questions-Responses and Short conversations There are basic reasons make the students poor listening: they are objective situation and subjective situation ... of the TOEIC is to measure the ability to speak, read and understand basic business English For this reason, the TOEIC has become the preferred exam for corporations, governmental agencies and ... test level 2, the case of: questions-responses and short conversations This survey has following purposes: 10 To research listening skill in TOEIC test, the case of: Questions- responses, and...
- 63
- 970
- 2
Tài liệu Digital Material - Tracing New Media in Everyday Life and Technology (Amsterdam University Press - Media Matters) ppt
... Oedipus interpassivity Games as sensual Games as pain re- Games as replicas Games as dratemptations lievers of non-virtual life matic stages for reality construction Table 2: Reactions toward cyberspace ... function as sign-tools She unravels these material metaphors as condensed icons that absorb and conceal their indexical relations to software and hardware processes Similar to Kessler, she discusses ... good-versus-evil (Taylor 1998), we and us in Americas Army always stands for the US Army Make no mistake, in Americas Army you are always with us/US It is one of the oldest and most common propaganda...
- 305
- 415
- 0
Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf
... It is also clear from comparisons of panels c and d that the hydrolysis rates of the Tyr146-Asn147 and the Asn147-Ala148 bonds were similar and that, indeed, the replacement of Asn147 was also ... assay buffer For details of various enzyme incubations see Materials and methods Residual enzyme activities were measured at 37 8C in the assay buffer at 100 mM substrate concentration as described ... D-chymotrypsinogen and its mutants by D-chymotrypsin (Fig 3B), the order and speed of cleavages are as follows: the rapid cleavage of the Tyr146-Asn147 and/ or the Asn147-Ala148 bond (s) in the autolysis...
- 9
- 613
- 0
Employment and Skills in South African Exports pot
... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...
- 35
- 297
- 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx
... identification of plasmodiumspecific mRNAs on the basis of suppressive substractive hybridization (SSH) using cDNAs of plasmodial extracts as tester and of amoebal extracts as driver A large number ... In the case of NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, the resulting ... NcoI and SpeI at 37 °C for 1.5 h and was analysed on a 2% agarose gel The purified DNA fragment was used as standard Total RNA was isolated from cells of the different stages in the life cycle, and...
- 10
- 639
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25