the focus of text fields is controlled by the left and right keys at top the left text field is focused the blinking insertion point is visible inside the text field at bottom the right text field is focused
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf
... fgl2 mRNA The left side of the figure is the sequence ladder using the same primer and the pM166 clone as template Arrow indicates the nucleotide that is matched to the band present in the primer ... indicate the bands that are interacting with these probes All the lanes have labelled probes The adding of extracts and cold probe are indicated in the top of the panel Supershift, ss-Sp1 and ... (pCR3.1) Mutation of the Sp1/Sp3 (mut4) site completely abolished this activation Discussion Evidence indicates that inducible expression of fgl2 correlates with the vascular thrombosis of the liver...
- 13
- 525
- 0
Báo cáo Y học: Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules pptx
... formed by the aminoacid residues at the N- and C-termini of PR contribute close to 75% of the total Gibbs energy [15] The importance of this four-stranded b sheet is further emphasized by the fact ... D29 and R87 of one subunit and R8 of the other subunit Thermodynamic analyses of the dimeric PR molecule indicates a Gibbs energy of dimer stabilization of 10 kcal/mol at 25 °C (pH 3.4), consistent ... energy is not sufficient to induce subunit dissociation in the absence of denaturant [44] High-level drug resistance to TSAO is mediated by the E138K mutation in the p51 subunit of HIV-1 RT [55] The...
- 9
- 494
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... during maturation of clone 3F, because scFv 6009F accumulated three changes at CDRs and three at the frameworks We surmised that the changes at the frameworks contributed to the generation of a ... One of these changes occurred at framework of the heavy chain (Asp74Asn) and of the light chain Two of the changes (Thr152Ile and Ser197Gly) occurred at frameworks and 3, respectively, and the ... neutralize LD50 of the whole venom This is the first recombinant human antibody fragment that neutralizes C noxius venom To the best of our knowledge, this is the first report of the generation of a human...
- 11
- 679
- 0
The Project Gutenberg EBook of Evolution in Modern Thought, by Ernst Haeckel and J. Arthur Thomson ppt
... especially by his analysis of what occurs in the case of domestic animals and cultivated plants, and by his elaboration of the theory of Natural Selection which Alfred Russel Wallace independently stated ... organic evolution—that the present is the child of the past is in great part just the idea of human history projected upon the natural world, differentiated by the qualification that the continuous ... the pioneers of the evolution-doctrine is weakened by his habit of vacillating between his own conclusions and the orthodoxy of the Sorbonne, but there is no doubt that he had firm grasp of the...
- 876
- 465
- 0
Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx
... in this experiment A DN forms of Vps4A and Vps4B Both Vps4AEQ and Vps4BEQ have point mutations that render them defective in ATP hydrolysis B DN forms of AIP1/Alix AIP1/Alix is composed of three ... 1.0 The data represent averages and standard deviations (SD) of independent experiments SU designed the study, carried out experiments, participated in analysis of the results, and wrote the ... forms of the class E proteins Our results showed that the DN forms of Vps4A, Vps4B, and AIP1 markedly suppressed VLP production, suggesting that HTLV-1 budding utilizes the MVB pathway and that these...
- 5
- 303
- 0
Báo cáo hóa học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx
... in this experiment A DN forms of Vps4A and Vps4B Both Vps4AEQ and Vps4BEQ have point mutations that render them defective in ATP hydrolysis B DN forms of AIP1/Alix AIP1/Alix is composed of three ... 1.0 The data represent averages and standard deviations (SD) of independent experiments SU designed the study, carried out experiments, participated in analysis of the results, and wrote the ... forms of the class E proteins Our results showed that the DN forms of Vps4A, Vps4B, and AIP1 markedly suppressed VLP production, suggesting that HTLV-1 budding utilizes the MVB pathway and that these...
- 5
- 309
- 0
Survey findings of goat production in Ninh Thuan, Binh Thuan and Lam Dong at the second year implementing card project doc
... a systematic and more thorough study of this disease in the south of Vietnam This is another example of poor management by project staff of this program, and also indicates little liaison between ... carriers of the disease Mr Tatu was advised to immediately isolate does and their infected kids from the rest of the herd until kids were at least weeks old when they can ve vaccinated against goat ... March) and then again later by DARD staff There is no record of this vaccination in the records available There has been no report or investigation made of this incident, which further makes the...
- 31
- 543
- 0
Báo cáo toán học: "Receipt of Standard Breast Cancer Treatment by African American and White Women" doc
... radiation therapy, and hormone therapy according to NCCN recommendations If the patient received all of these treatments, the patient received standard of care If the patient also received chemotherapy ... because this information was not available from the ASCR Another limitation was that 17.7% of cases (N=1721) were missing information on stage at diagnosis Without the stage at diagnosis, the standard ... treatment than recommended For example, if the NCCN recommended only chemotherapy and the patient received chemotherapy and radiation therapy, the patient received the additional treatment of...
- 8
- 257
- 0
Báo cáo y học: "Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants" ppsx
... to the analysis of the KOG-to-COG clusters and the analysis of protist sequences and commented on the manuscript HM conceived of and supervised the study and critically revised the manuscript ... diversifications, the hypothesized WGD/SDs could provide an explanation at the level of genome evolution for the high rate of speciation near the origin of the three major eukaryotic lineages Materials ... about the fate of the ancient duplicates, we also examined whether specific duplicates were retained or lost, and found that different orthogroups varied in their patterns of retention of duplicates...
- 13
- 384
- 0
Báo cáo y học: "Successful use of therapeutic hypothermia in an opiate induced out-of-hospital cardiac arrest complicated by severe hypoglycaemia and amphetamine intoxication: a case report" pdf
... resuscitation, clinical follow-up of the patient and conceived the idea of possible publication of the case MB and ES both Page of participated equally in the literature research and the process of ... correlation between the additive effect of concurrent hypoglycaemic and ischemic-anoxic insults exists, partly due to the difference in the degree and distribution of neuronal necrosis of the two ... from the patient for publication of this case report A copy of the written consent is available for review by the Editor-in-Chief of this journal Authors’ contributions MB carried out the initial...
- 3
- 267
- 0
Fabrication of low loss silicon waveguides by ion irradiation and electrochemical etching
... depth The penetration depth and the end of range of proton beams in different materials are determined by the proton beam energy The end of range of protons and the profile of the penetration path ... fabrication of waveguides with low propagation loss are the main focus of the thesis This chapter starts with the study of the wave function and the polarization of the light, in order to understand the ... amplifier that controls the scan size of the ion beam along with the X and Y axis ratio of the scanned area This software enhances the function of the Scan 21 Amplifier, and enables the writing of complicated...
- 157
- 499
- 0
Functional diversity of cav1 3 channels generated by RNA editing and alternative splicing
... that alternative splicing in the 19 IS5 -IS6 region and I-II loop significantly altered the activation property of the channel while that in the IVS3-IVS4 region modulated the sensitivity of the ... 5’-TGTGGGAAGTTGTCGAAGGTGCTTCGCTTGGTTTGCATTTCATCAAAAGT AACAGCATAATCAGGAACATCATAAGGATA -3’; Subsequently the HA oligo was joined to two DNA fragments upstream and downstream of the point of insertion of HA tag by overlapping ... al., 2005) and finally the occlusion of the gate by the I-II loop in a ‘hinge lid’ mechanism Interestingly, a recently identified “shield’ that repels the closure of the channel gate by the I-II...
- 119
- 302
- 0
Novel methods for quantitative analysis and evaluation of effects of chronic exposure to microcystins by capillary electrophoresis and metabolomic studies
... migrate to a point where its net charge is zero (isoelectric point or pI), at this point migration stops and the sample is focused into a tight zone The zone is then mobilized past the detector by ... migration, the solute will not migrate when it is neutral, at its isoelectric point, and this is the principle applied in isoelectric focusing A pH gradient is generated between the cathode and ... the buffer and , is the charge on the particle, is the viscosity of is the radius of the particle The mobility of an ion is directly proportional to its charge and inversely proportional to the...
- 177
- 292
- 0
A PRAGMATIC CULTURAL ANALYSIS OF COHESIVE DEVICES IN SPEECHES BY BARRACK OBAMA AND MITT ROMNEY IN UNITED STATES PRESIDENTIAL ELECTION 2012
... captured the world’s attention Speeches by them have not only attracted the interests of political scientists and historians, but also attained the attention of linguists Many researches focused on the ... study, the author has employed the Quantitative Method It means that the thesis focuses more on the collection and analysis of numerical data and statistics Counting and measuring are common form of ... study of how and for what purposes language is used in certain of context of situation and the linguistic means to carry out these purposes” This means that analysis of discourse looks not only at...
- 56
- 554
- 1
hydrothermal properties of materials experimental data on aqueous phase equilibria and solution properties at elevated temperatures and pressures
... temperature and pressure, ignoring the study of phase transitions The dynamic (flow) methods are distinguished from the static ones by the fact that at least one of the phases in the system is subjected ... collection of the experimental calorimetric data is available on the CD In the final version of this book each chapter consists of two parts: the descriptive text part that appears in the pages of this ... publication is designed to provide accurate and authoritative information in regard to the subject matter covered It is sold on the understanding that the publisher is not engaged in rendering professional...
- 300
- 437
- 0
Our customer is in the focus of our attention.
... (internal and external) expect and pay for solutions - and not the explanation of their problems c o l o r w o r k s f o r y o u Corporate Culture and Values We know that authenticity is everything ... opportunity We know that in Chinese, CRISIS is a compositum of Threat and Opportunity We love speed At the same token we know, that sometimes we have to go slow to go fast We know that it is useless to ... what happens to companies that refuse to change - If change outside the company is greater than inside, the end is near (Jack Welch / GE) - In the future there will be two types of companies: The...
- 13
- 379
- 0
Théorie des Fonctions Elliptiques, by Charles Briot and Jean Claude Bouquet This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever docx
... Produced by Laura Wisewell, Andrew D Hwang, Amy Cunningham, Colin Bell, and the Online Distributed Proofreading Team at http://www.pgdp.net (The original copy of this book was generously ... generously made available for scanning by the Department of Mathematics at the University of Glasgow.) Ce livre ộlectronique est dộdiộ la mộmoire de Laura Wisewell, notes sur la transcription ... par le Dộpartement des Mathộmatiques, Universitộ de Glasgow Des modications mineures ont ộtộ apportộes la prộsentation, lorthographe, la ponctuation et aux notations mathộmatiques Le A chier L...
- 636
- 823
- 0
The future of internal audit is now Increasing relevance by turning risk into results pot
... organization’s overarching organizational strategy to identify the risks that matter most in the context of the organization’s risk appetite Elements of the organizational strategy will vary by industry ... that focuses on organizational strategic imperatives and key business risks identified during the risk assessment, including an appropriate blend of: • Advisory and assurance reviews • Thematic ... horizon and have a road map that is based on the organization’s overall strategy, stakeholder expectations, regulatory requirements and the role of the other risk functions Risk-based approach “Inefficient,...
- 24
- 382
- 0
Autobiography and Letters of Orville Dewey, by Orville Dewey1Autobiography and Letters of Orville Dewey, by Orville DeweyThe Project Gutenberg EBook of Autobiography and Letters of Orville Dewey, D.D., by Orville Dewey This eBook is for the use of an pptx
... that the constitution of the world is good, and that the constitution of human nature is good; that the laws of nature and the laws of life are ordained for good I believe that man was made and ... that immediate emancipation was theoretically the best plan It was forced upon us by the exigencies of the war And, independently of that, such was the infatuation of the Southern mind on the ... the house, and the steeds of willow sticks cut there, and beyond the unvarying gentleness of my mother and the peremptory decision and playfulness at the same time of my father, his slightest...
- 141
- 503
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008