the description of a person discontented with the present government and apprehensive of the loss of our liberties
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC GCGGGATCCCGCAGGGTGAACTCTGCCTCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCCCCCTGCCGAAGTGGACCCT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT...
- 14
- 517
- 0
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt
... postoperative day The antibiotic therapy with ampicillin was totally administered for six weeks Histological examination showed that the mass was an infected atrial myxoma, and gram staining of the ... thrombus and vegetation (*) (B): Hematoxylin and eosin (HE) and showed that the mass was an atrial myxoma, and gram staining of the infected portion revealed the presence of gram-positive coccal bacteria ... 10 days after surgery as a result of DIC [5] Our case, which presented with both a bacterial cerebral infarction and DIC, is the second successful case Yoshioka et al Journal of Cardiothoracic...
- 4
- 543
- 0
báo cáo khoa học: " Drug Checking: A prevention measure for a heterogeneous group with high consumption frequency and polydrug use - evaluation of zurich’s drug checking services" potx
... same as the number of substances analyzed (2055) Of the subjects, 21.9% were women, and the average age was 27.8 years At the time of the survey, the youngest person was 15, and the oldest was ... 37.6% of the users indicated that they had had a “bad trip” Another 20.9% said that they had suffered from symptoms of depression, and 14.9% had suffered from panic attacks Another 24.8% had family ... collected on a group of users that has been largely unknown so far Thanks to the collection and evaluation of the presented data, the city of Zurich today has a much greater knowledge of the substances...
- 6
- 267
- 0
Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc
... statistical advice and insightful comments Author Details 1Medical Research Council, Fajara, The Gambia, 2Municipal Health Service and Academic Medical Centre, Amsterdam, The Netherlands, 3Department ... infected persons with available results (and the same being true for HIV-negative persons) Statistical methods Data were double entered in an Access (Microsoft, Redmond, WA, USA) database and validated ... the largest community based study which has measured the prevalence and incidence of HTLV-1 and its associations with HIV These data show a high HTLV1 prevalence of approximately 5% and a stable...
- 9
- 336
- 0
Báo cáo y học: " The first description of severe anemia associated with acute kidney injury and adult minimal change disease: a case report" ppsx
... content of the paper EF interpreted patient data and the literature and critically reviewed the content of the paper All authors read and approved the final manuscript Acknowledgements The renal biopsy ... Figure Therapy scheme and resultant changes in hematocrit (A) and creatinine levels (B) of the patient Therapy scheme and resultant changes in hematocrit (A) and creatinine levels (B) of the patient ... during the first 14 days of the initiation of renal replacement therapy In contrast, in our case, high-dose EPO was initiated at the onset of ARF and days before the significant drop in hematocrit...
- 6
- 316
- 0
Items for a description of linguistic competence in the language of schooling necessary for learningteaching sciences (at the end of compulsory education) An approach with reference points
... basic values of human rights, democracy and the rule of law and make them part of their personal ethics The languages of Europe are inter alia a means of acquiring knowledge, of engaging in exchanges ... the CEFR p 58); Emphasise the stages of the presentation as it unfolds; Present and organise the linguistic commentary of tabulated data, a diagram, etc.; Make the presentation attractive: manage ... Educational Values and Science Education All teaching pursues educational goals over and above the expertise and learning which are both its substance and its aspiration The role of languages of...
- 29
- 645
- 0
Tài liệu Lombard Street: A Description of the Money Market docx
... reserve at the Bank of England, they are liable to fail if it fails They are dependent on the management of the Bank of England in a day of difficulty and at a crisis for the spare money they keep ... was that they should be paid on demand, and if they are not paid on demand they may be ruined And that instant payment, in the years I speak of, the Bank of England certainly could not have made ... because they saw that the Banking reserve was already low, and that it was daily getting lower The two maladiesan external drain and an internal-often attack the money market at once What then ought...
- 102
- 430
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... in case K = Q, and by Datskovsky and Wright in general [6]; and for n = 4, and K = Q by Bhargava [3], [2] A weaker version of the conjecture for n = was also recently established by Kable and ... Annals of Mathematics, 163 (2006), 723–741 The number of extensions of a number field with fixed degree and bounded discriminant By Jordan S Ellenberg and Akshay Venkatesh* Abstract We give an...
- 20
- 478
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... toroid, and is closely similar to that of the catalytic domain of A awamori and T thermosaccharolyticum glucoamylases, with the active site at the narrower end of barrel There is no terminal starch-binding...
- 11
- 548
- 0
A Brief Memoir with Portions of the Diary, Letters, and Other Remains, potx
... her Journal:-6th Mo 12th Many and great have been the favors dispensed within the last five weeks The attendance of the Yearly Meeting has been the occasion of many and solemn warnings and advices, ... the whole And not more slow than was the bark that bore thee To an untried and dimly-distant land -Our hearts' affections thither flew before thee, And now are ready waiting on the strand 8th ... thoughts and intents of the heart The chief purport was the necessity of a willingness to learn daily of the great Teacher meekness and lowliness and faithfulness in the occupation of the talents...
- 95
- 517
- 0
Báo cáo khoa học: Utp25p, a nucleolar Saccharomyces cerevisiae protein, interacts with U3 snoRNP subunits and affects processing of the 35S pre-rRNA docx
... 5¢-GGATCCATGGGC AAACGCGGGAGCC-3¢ and 5¢-ATCGATGTCGACTCA TTTTTCTCCAGTAATGAAGAG-3¢ The gene was cloned in fusion with yEGFP3 using BamHI and SalI sites of pUG34 This vector was cleaved with XbaI and ... 5¢-GGTCTCTCTGCTGCCGGAAATG-3¢ 5¢-CATGGCTTAATCTTTGAGAC-3¢ 5¢-GCTCTCATGCTCTTGCCAAAAC-3¢ 5¢-CGTATCGCATTTCGCTGCGTTC-3¢ 5¢-CTCACTACCAAACAGAATGTTTGAGAAGG-3¢ 5¢-GTTCGCCTAGACGCTCTCTTC-3¢ 5¢-GCCGCTTCACTCGCCGTTACTAAGGC-3¢ ... this pathway was analyzed by northern hybridization The results show that upon depletion of Utp25p there is an accumulation of the pre-rRNA 35S and the aberrant 23S, and a decrease in pre-rRNA 20S...
- 15
- 328
- 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
... to the region )148 to )124 of c-jun and stimulates transcription Materials and methods Reagents and animals All chemicals were of reagent grade and were from Sigma Chemical Co unless stated otherwise ... the reaction mixture was placed on ice and UV irradiated (254 nm) for 15 [25] Following irradiation, the mixture was separated by SDS/PAGE (15% acrylamide) and analysed by autoradiography changes ... Twentyfour h after transfection, the DNA-containing medium was replaced with mL normal growth medium and incubated at 37 °C in a 5% CO2 incubator for an additional 48 h Medium was again removed and...
- 9
- 449
- 0
COSMOS A SKETCH OR A PHYSICAL DESCRIPTION OF THE UNIVERSE ppt
... degree of geographical latitude Equality of the mean temperature of a mountain station, and of the polar distance of any point lying at the level of the sea Decrease of temperature with the decrease ... currents and temperature Depths of the ocean and of the atmosphere, the shoals of which constitute our highlands and mountain chains The degree of heat at the surface of the sea in different latitudes ... latitudes and in the lower strata Tendency of the sea to maintain the temperature of the surface in the strata nearest to the atmosphere, in consequence of the mobility of its particles and the alteration...
- 792
- 272
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... water and titrated to pH 7.0 with KOH ADP and ATP were purchased as a potassium salt of the highest purity available and titrated to pH 6.9 (KOH) Statistics Data are presented as mean ± standard ... static, assisting the reliable calculations of the total amount of CaCl2 added What is apparent from Fig 1A, B is that both ADP and ATP significantly decreased Ca2+ uptake rates as compared with ... in the designated areas a, b, and c Yellow represents the part of the bovine ANT that is different from the Artemia ANT; the latter is depicted in magenta Regions a, b and c are marked on the aligned...
- 15
- 505
- 0
Báo cáo khoa học: The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups pot
... H4 labeled A2 a, A2 b, A3 a, A3 b, A4 a and A4 b, respectively (Fig 4A) The 1D-NOESY of Gal H- 4a showed NOEs for Gal H- 2a, Gal H- 3a, Gal H-5 and Gal H-6 ⁄ 6¢, as well as for Fru H-4 and Fru H-6 ⁄ 6¢ ... structural artifacts complicated NMR and mass spectrometry data and as a result, hindered the identification of these labile branches and MeOPN groups In contrast, spectroscopic data acquired for an ... and a scalar coupling 3JP,H of 11.1 Hz was observed CPS-2 Atom Type dH dC A1 A2 a A2 b A3 a A3 b A4 a A4 b A5 A6 ⁄ A6 ¢ B1 ⁄ B1¢ B2 B3 ⁄ B3¢ C1 ⁄ C1¢ C2 C3 C4 C5 C6 ⁄ C6¢ MeOPN C1 ⁄ C1 a C 2a C 3a C4a...
- 16
- 466
- 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... subjects (CA genotype) was PCR amplified using a forward primer starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢) and the same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢) ... nucleotides )132 and +74 (forward: 5¢-GAATGTGGGTCTCAGAGTTCC-3¢ and reverse: 5¢-GGCAGAGAAAACTCGAGAAC-3¢) were designed to generate a 206 bp 5¢ flanking DNA fragment For DHPLC analysis, PCR was performed ... Trisborate and mM EDTA) at a constant voltage of 190 V, then dried and autoradiographed using intensifying screens The concentration of nuclear protein extracts used in each reaction was lg and that...
- 9
- 462
- 0
báo cáo hóa học: "The psychometric validation of a US English satisfaction measure for patients with benign prostatic hyperplasia and lower urinary tract symptoms" potx
... participated in the study design, analysis and interpretation of data and drafting the manuscript BM participated in the acquisition of data and the revision of the manuscript All authors read and approved ... criteria such as requiring a patient to have a minimum score of 12 or greater in the LB participated in the study design, the analysis and interpretation of data and revision of the manuscript AG participated ... additional useful information on patient satisfaction with BPH pharmacotherapy above and beyond what was already provided by global satisfaction A draft of the questionnaire was developed on the basis...
- 8
- 491
- 0
báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf
... PS was responsible for the conception of the study, analyzing the data, and writing the article RC contributed to analyzing the data and the interpretation of the results RS contributed to analyzing ... analyzing and collecting the data All authors have read and approved the final manuscript Acknowledgements This research was supported by a grant from Chulalongkorn University The authors thank diabetic ... problem A total of 243 possible health states are generated The UK valuation study was conducted based on the Measuring and Valuation Health (MVH) protocol to collect a general adult population in the...
- 9
- 498
- 1
Báo cáo hóa học: " Evaluation of quality of life and description of the sociodemographic state in adolescent and young adult patients with phenylketonuria (PKU)" docx
... questionnaires Both conducted the realisation and the analysis of the study and helped to draft the manuscript JR participated in the design of the study and participated in the analysis of the questionnaires ... questionnaires JR did the data collection ND, MG and JS participated in the design and the data analysis ND did the statistical analysis GK participated in the design of the questionnaires and helped ... table Data on school and professional education are summarised in table A great percentage of patients still lived with their parents (48% of the male and 46% of the female patients) in contrast...
- 7
- 417
- 0
báo cáo hóa học:" Salter-Harris II injury of the proximal tibial epiphysis with both vascular compromise and compartment syndrome: a case report" docx
... wrote the manuscript Both authors read and approved the final manuscript References Peterson CA and Peterson HA: Analysis of the incidence of injuries to the epiphyseal growth plate J Trauma 1972, ... used conservative measures for displaced type I and II (MUA and cast in varying degrees of flexion) and open reduction and internal fixation of displaced type III, IV and V Some authors regret ... had associated ligamentous injures (anterior cruciate (ACL) 4, medial collateral and both 1) [6] Poulsen et al also illustrated similar ligamentous injuries, with out of 15 patient suffering ACL...
- 5
- 420
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008