that this standard proposes that much of the information to be disclosed need only be supplied in this form is t
The simple present of the verb to be
... American Use of the simple present of to be The principal use of the simple present is to refer to an action or event that takes place habitually, but with the verb "to be" the simple present tense ... refers to a present or general state, whether temporary, permanent or habitual • I am happy • She is helpful The verb to be in the simple present can be also used to refer to something that is true ... subject and object pronouns.) am, are, is are forms of the verb to be in the simple present 'm, 're, 's are short (contracted) forms of am, are, is 'm not, aren 't, isn 't are short (contracted forms)...
- 2
- 212
- 0
ease guidelines for authors and translators of scientific articles to be published in english
... terminate end the test in question this test there can be little doubt that this is this is probably to an extent equal to that of X as much as X utilize use whether or not whether Based on O’Connor ... arranging text-tables The larger a text-table is, the less power it has The sentence that precedes the text-table acts as a heading that introduces the information the text-table represents, and ... time This slightly decreases the strength of the information Quicker access to the information can be achieved within a sentence, but this is not an effective structure if more than two numbers...
- 16
- 449
- 0
Báo cáo y học: "Treatment of Hereditary Angioedema: items that need to be addressed in practice parameter" ppt
... imminent attack The results, demonstrated in figure indicate that (6.5%) patients could predict the onset of symptoms 100% of the time; 23 (50.0%) answered the ability to predict acute attacks ... within hours to days This would allow patients who experience prodromal symptoms to preemptively treat themselves in the hopes that it would prevent an imminent attack and the symptoms that cause ... icatibant will be approved in the USA in 2012 Discussion The treatment of acute attacks and prophylactic treatment of HAE has been evolving In the recent past, the treatment of acute attacks was largely...
- 7
- 441
- 0
Báo cáo y học: "A cluster randomized trial of standard quality improvement versus patient-centered interventions to enhance depression care for African Americans in the primary care setting: study protocol NCT00243425" doc
... administrative assistants) at Johns Hopkins, the staff at all of the participating clinical sites, all of the participating clinicians, the organizational leaders, and the patients, for making the ... If they agreed, a field research assistant met the patient at the clinic prior to their next appointment The research assistant administered the brief screening questionnaire, and the recruitment ... recruitment, and the patients did not know their assigned treatment status until after enrollment Due to the behavioral nature of the interventions, blinding or masking of study participants, investigators,...
- 15
- 410
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... báo thông tin 11 Đèn báo sấy nóng bugi/dầu diesel 12 Đèn cảnh báo trời sương giá 13 Đèn báo b t công t c khóa điện 14 Đèn báo chìa khóa không nằm ổ 15 Đèn cảnh báo khóa bấm điều khiển t xa h t ... Đèn báo không th t dây an to n 31 Đèn báo phanh đỗ xe 32 Đèn cảnh báo h t ắc-quy/lỗi máy giao điện 33 Đèn báo hỗ trợ đỗ xe 34 Đèn báo xe cần bảo dưỡng 35 Đèn báo hệ thống chiếu sáng thích ứng 36 ... cảnh báo mui xe mui trần 39 Đèn cảnh báo t i khí 40 Đèn cảnh báo phanh tay 41 Đèn báo nước vào lọc nhiên liệu 42 Đèn báo t t hệ thống t i khí 43 Đèn báo lỗi xe 44 Đèn báo b t đèn cos 45 Đèn báo...
- 3
- 508
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... shouldn t laugh at funeral Have to/ don t have to/ important to/ important not to – Điều CẦN làm >< không CẦN làm Vd: You have to call me first – It’s important that you call me first Vd: You don t have ... Vd: The richer she is the more selfish she becomes The more intelligent he is the lazier he becomes Dạng khác(càng ) The + S + V + the + comparative + S + V Vd: the more we study the more stupid ... gọi t nh t ngắn M t số t nh t có hai vần k t thúc "le","et","ow","er"vẫn xem t nh t ngắn -4 Các t nh t so sánh b t quy t c học thuộc lòng good/better /the best bad/worse /the worst many (much) /more/the...
- 7
- 425
- 0
Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx
... signalling, including the activation of NF-jB and AP-1 (Fig 3A) This suggested that the T4 SS might inject factors in addition to CagA or that the T4 SS itself triggers the effect Despite intensive ... and that these interactions contribute to the H pylori-induced elongation phenotype of AGS cells Taken together, these findings demonstrate that injected or transfected CagA can interfere with ... defect in T4 SS functions such as phosphorylation of injected CagA during infection in another study [13] These studies indicate that there is a controversy in the literature about the importance of...
- 13
- 866
- 0
Tài liệu Cleaner Water in China? The Implications of the Amendments to China’s Law on the Prevention and Control of Water Pollution pptx
... similar to the standards in the United States The EPA sets treatment standards by regulation according to industry.85 In doing this, the Id at 379 Id 79 Law on Prevention and Control of Water Pollution ... However, it is yet to be determined whether the new ministry will be able to exert additional control.18 10 W Scott Railton, Comment, The Rhetoric and Reality of Water Quality Protection in China, ... Basin.93 It is unclear how the total control program is to be implemented or how responsibility is to be shared The State Council is supposed to formulate the rules for allocation of the total...
- 22
- 661
- 0
Tài liệu Báo cáo khoa học: On the mechanism of action of the antifungal agent propionate Propionyl-CoA inhibits glucose metabolism in Aspergillus nidulans doc
... lead to a strong accumulation of propionyl-CoA in the DmcsA-strain, the activity of methylisocitrate lyase is twice as high than that of the wild-type The addition of acetate to these media not only ... propionyl-CoA is supposed to be generated in the cytoplasm For transport to the mitochondria a conversion into a carnitine-ester and a backconversion to the CoA-ester inside the mitochondria has to be involved, ... conidiation is affected Utilization of acetate by the acetyl-CoA synthetase mutant is strictly dependent on the activity of the predicted propionyl-CoA synthetase Strain SMB/acuA shows better growth...
- 15
- 678
- 0
HISTORY OF THE EXPEDITION TO RUSSIA, UNDERTAKEN pdf
... last affected to have cut out for himself a destiny independent of his From that moment his instructions to his minister bore the impress of that disposition; the latter, it is true, softened the ... determined the sultan to throw off the yoke of Alexander The English made hasty attempts to oppose this, but they were driven from the sea of Constantinople Then it was that Napoleon wrote the ... latter—Want of concert in the movements of the Russian generals II —Junction of the corps of Saint Cyr and Victor at Smoliantzy on the 31st October—Opportunity lost by the latter of defeating the...
- 528
- 358
- 0
The six business models for copyright infringement: A data-driven study of websites considered to be infringing copyright docx
... string that defines a realm of administrative autonomy, authority, or control on the Internet In this report the term domain is used to refer to the single string selected by the owner of that ... site to the training sites that it was most similar to We then assigned the validation site to the same cluster as its match This had the advantage that the validation site could be assigned the ... (Google) to investigate the characteristics of websites that are alleged to infringe copyright There have been many studies and surveys of online copyright infringement but this report is the first to...
- 64
- 343
- 0
Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt
... filtering, to inadequate guarantees of the right to privacy and protection of personal data, which inhibit the dissemination of opinions and information The Special Rapporteur is of the view that the ... attributed to the State, it clearly constitutes inter alia a violation of its obligation to respect the right to freedom of opinion and expression Although determining the origin of cyber-attacks ... all States of their positive obligation to promote or to facilitate the enjoyment of the right to freedom of expression and the means necessary to exercise this right, including the Internet Hence,...
- 22
- 400
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... the distribution of these mRNA forms is comparable between Xenopus and rat, except for the high levels of mRNA forms containing exon 14 in Xenopus stomach, intestine and ovary Taken together, the ... PCR product indicates the absence of exon In all of the Xenopus tissues examined, mRNA forms that were lacking exon were present In intestine and stomach, and to a lesser extent in brain, liver ... resulted in the appearance of the APLP1 and APLP2 gene families The fact that both mammals and Xenopus contain APP and APLP2 proteins suggests that the first gene duplication giving rise to the...
- 7
- 405
- 0
Báo cáo khoa học: Bioenergetics of the formyl-methanofuran dehydrogenase and heterodisulfide reductase reactions in Methanothermobacter thermautotrophicus pot
... or 25 lM TCS) By the incubation, formylmethanofuran is quantitatively converted into methanofuran In this way, the total methanofuran content could be determined The following steps took place ... concluded that formyl-methanofuran synthe¨ sis is connected to the translocation of two to three Na+ per reaction in case of M barkeri; the number could be three to four for Methanothermobacter In this ... the cell membrane [12] M thermautotrophicus neither contains methanophenazine, nor the cytochrome b-type proteins that are typical for the Methanosarcina electron-transport chain In an in vitro...
- 10
- 421
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG CCTCATTTCCTCCGGGAAGACTTTTGAATAC CGGACAAGGTGAGGACTTGGTACTTACTGGATAC CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Proteases ... open active-site cleft, is comparable to that of Leu73 in the second binding loop of cystatin B and to that of the essential Trp106 residue in this loop of the family cystatin, cystatin C [37,52] ... from that of cystatin B Most notably, cystatin A lacks the essential His75 and instead has a Gly in this position [1] This substitution would be expected to lead to loss of a number of interactions...
- 10
- 533
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25