sum speaking skill which plays a vital part in the teaching and learning of english require the endeavor of both teachers and students to gain the mastery of it
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx
... Cyp 2a5 ; 5¢-TTGTTCTAAAAGTTGTGCCACGG GATG-3¢ and 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ... 5¢-CGCAGGAATGGATAAACATA AGCA-3¢ for Cyp2c38; 5¢-ACTTCTCTGTGGCAAGCCC TGTTG-3¢ and 5¢-TCCACTAGCACAGATCACAGATC ATGG-3¢ for Cyp2b9; 5¢-TGCAGAACTTCCACTTCAA ATCCA-3¢ and 5¢-AATTTCCCCCTTCTCTGGCTACC-3¢ ... 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-3¢ for Akr1b8; 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢...
- 9
- 280
- 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
... vertical bars in the top part of the figure The size of each exon is indicated in the bottom panel the database revealed that the GT ⁄ AG rule was maintained in all cases (data not shown) The deduced ... and northern blotting Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using ... [25,35,36] In order to examine the functional role of the FAD49 PX domain, we characterized its PX domain Lipid binding studies and in vitro binding studies showed that the PX domain of FAD49 has affinity...
- 13
- 385
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... peritoneal macrophages stimulated with the endomembrane Ca2+-ATP-ase inhibitor thapsigargin [34] They assumed this effect to be due to inhibition of CoA-independent acyltransferase activity as ... experiments each carried out in duplicate isolated and incubated in the same way as the experiments with MonoMac cells (Fig 3) In addition to TNF -a, the in ammatory cytokine IL-6 was also measured to check ... containing 0.01% H2O2 (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The...
- 7
- 322
- 0
Báo cáo hóa học: " On calculation of eigenvalues and eigenfunctions of a Sturm-Liouville type problem with retarded argument which contains a spectral parameter in the boundary condition" pot
... problem with retarded argument which contains a spectral parameter in the boundary condition Then, under additional conditions (a) and (b) the more exact asymptotic formulas, which depend upon the ... retardation obtained Şen and Bayramov Journal of Inequalities and Applications 2011, 2011:113 http://www.journalofinequalitiesandapplications.com/content/2011/1/113 Authors’ contributions Establishment ... Establishment of the problem belongs to AB (advisor) ES obtained the asymptotic formulas for eigenvalues and eigenfunctions All authors read and approved the final manuscript Competing interests The authors...
- 9
- 410
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism Plant Cell 2006, ... M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana Plant J 2000, 23:171-182 Kataoka T, Hayashi...
- 10
- 427
- 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... demonstrate an increased translation of these transcripts and validate the array data indicating no change or a slight decrease in LTBP1, SYNE-1 and MMP3 transcript levels in the total RNA compartment and ... susceptibility to apoptosis and included the initiator caspase 8, insulin growth factor-binding protein (IGFBP)1, inhibitor of hepatocytic proliferation in vivo and in vitro [23], the interferon-induced ... and polysomal of the array data by on sucrose gradient Validation Validation of the array data by real time PCR (a) using total and polysome-bound RNA populations and (b) using individual fractions...
- 14
- 384
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan ... activity of GALA with different arabinogalactans was measured in duplicate by HPAEC and MALDI-TOF MS after incubation of mgÆmL)1 of potato, onion and soy arabinogalactan with 1.33 lgÆmL)1 GALA at ... b-1,4-endogalactanases reported release of D-galactose and D-galactobiose from arabinogalactan, after initial release of D-galactotriose and D-galactotetraose [10,12,36,39] However, none of these papers...
- 9
- 669
- 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot
... et al Fig Analysis of probe labelling of mutant TM12 isoforms of ABCB1 For each of the mutant isoforms, densitometric analysis was used to quantify the UV images and values of labelling at each ... nucleotide-free) state; the extent and time course of labelling are shown in Table All of the mutant isoforms examined were capable of interacting with CM, which has a high octanol ⁄ water partition coefficient, ... labelling and its accurate quantitation are difficult to achieve in practice, resulting in occasional instances where values for the Lext of single-cysteine isoforms are apparently > 100% The approach...
- 12
- 380
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, no matter which ... was to construct the iron valency hybrid tetramers containing either the a or b chains in the ferric state, and to examine for their stability properties as compared with the native HbO2 and its ... Thus, the remarkable stability of the HbO2 tetramer can be ascribed mainly to the delayed autoxidation of the b chains in acidic pH range More speci®cally, the b chain has acquired this stability...
- 10
- 648
- 0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt
... acetylsalicylic acid (ASA) was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was ... than aspirin in inhibiting the effect of ADP on platelets in blood and (2) NSC23766 inhibits a- granule secretion and platelet aggregation stimulated by ADP independent of platelet prostaglandin-endoperoxide ... interaction of Rac1 with TrioN or Tiam1 Rac-GEFs, and it has been shown to inhibit in vitro both Rac1-TrioN binding and GEF activity of TrioN in a dose dependent manner, achieving 50% inhibition at 50...
- 10
- 441
- 0
báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc
... Figure Microarray analysis of anti-inflammatory/type I IFN and pro-inflammatory gene expression Microarray analysis revealed enhanced anti-inflammatory/type I IFN and comparable pro-inflammatory gene ... preconditioning changes the balance of proand anti-inflammatory cytokines and chemokines in the plasma we examined the levels of seven molecules using ELISAs The results indicate that the level of ... suppressed in the brain of LPSpreconditioned animals 24 hr post MCAO NFB activity is associated with damage and inflammation in the brain that occurs in response to stroke We used EMSAs to evaluate the...
- 12
- 215
- 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, ... TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The NheI-BamHI...
- 12
- 337
- 0
Báo cáo y học: "The prognostic value of blood lactate levels relative to that of vital signs in the pre-hospital setting: a pilot study" docx
... of the association of tachycardia with mortality because of the coding of heart rate as in cases of cardiac arrest Twelve patients had cardiac arrest at T1 Four patients died out -of- hospital ... seizures The baseline characteristics of the remaining 124 patients are described in Table The mean (standard deviation) time at the scene from arrival to departure of the ambulance was 16 (8) minutes ... nurses with two years of postgraduate training in a critical care setting (ICU, cardiac care unit, anaesthesiology or ED) and one year of training in EMSspecific procedures Selection of participants...
- 7
- 269
- 0
Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf
... (SOCS3) are key players in integrating NPRA signaling with innate immunity and in the induction of tolerogenic DCs Materials and methods Isolation, transfection and viability assay of human dendritic ... effects in a mouse model of asthma and anti-inflammatory activity in human epithelial cells [9] The amino acid sequence of this peptide is different from ANP and NP73-102 does not bind to NPRA and ... Dendroaspis natriuretic peptide, DNP, and urodilatin [3] The activities of ANP and BNP are similar, and their biological actions, such as vasodilation and natriuresis, are mediated through binding to their...
- 12
- 268
- 0
Ebook A first course in the finite element method (4th edition) Part 2
... longitudinal strain and the shear strain In Figure 9–4, the element is shown to displace by amounts u and w in the radial and longitudinal directions at point E, and to displace additional amounts ... define a position within the bar are found in a manner similar to that used in Chapter to define displacement within a bar (Section 3.1) We begin by relating the natural coordinate to the global coordinate ... determine the maximum von Mises stress and where it is located The material is ASTM A2 42 quenched and tempered alloy steel Use a factor of safety of against yielding The inner radius is a ¼ 100 inches...
- 421
- 1,175
- 0
Natural botanical products have a long history in the world and are featured in using a complex
... with trypsin for 30 at room temperature and incubated with a blocking agent (LSAB kit, DAKO, Copenhagen, Denmark) for hr They were then incubated with a rabbit anti-human von Willebrand factor ... Physiology at University of Hong Kong prior joining the company He had been the founding Editor and Editor -in- Chief of Biological Signals and Biological Signals and Receptors, Adjunct Professor of University ... expressed as the number of apoptotic cells per field Statistical analysis Statistical significance between the treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA),...
- 9
- 712
- 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... compared with official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land ... unit rainfall for each water quality parameter i and α is a normalization factor that depends on units and conversion factors Table Runoff coefficient and EMCs for land uses in Ballona Creek Watershed...
- 7
- 575
- 0
A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy
... pregnancy There was a significant further advance of her renal disease, necessitating the initiation of haemodialysis (a kidney machine) two years later, and a living, related donor renal transplant ... particularly important that the patient and her husband were made aware of the risks associated not only with the failure of IVF-ET but also with its success Arguments that could be advanced against ... anti-coagulation with heparin and warfarin was required Spontaneous rupture of the membranes, leading to premature delivery, occurred at 29 weeks’ gestation; the twins were delivered vaginally and in...
- 6
- 512
- 0
A STUDY ON UNREAL CONDITIONAL SENTENCES AND WAYS TO TRASLATE THEM INTO VIETNAMESE
... conditionals and ways to translate them into Vietnamese" in my paper The aims of the study The aims of this study are: - Categorizing English conditionals to help the readers have an insight into ... defines translation as a craft consisting an attempt to replace a written message and /or statement in one language by the same message and /or statement in another language E Nida, another famous ... evidence of a translation, a mean of retracting the partway of the translator’s decision making procedures” According to R J Bell (1991:7) in “Translation and Translating”, “Translation is the expression...
- 65
- 692
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu