receptacle for sample in dsc or dta which can be made from a variety of materials
Accounting for Changes in Social Support Among Married Older Adults: Insights From the MacArthur Studies of Successful Aging pptx
... time taken for gait was 35.8 s For balance and for five chair stands the maximum was 20.0 s for each, and for manual ability, it was 30.0 s The maximum time taken to complete 10 foot taps was 30.0 ... presents income data.) (A dummy indicator was used for participants with missing data so as not to incur participant loss.) Measures of Social Support The MacArthur battery included assessments of ... that each of the three types of social behaviors showed significant intercorrelations, with associations for negative behaviors showing the highest magnitude For example, participants who reported...
- 10
- 449
- 0
Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx
... CTTGGCTGCTTGCGAGCTGTTATTCT TTTCAATCC; LmS12 2A (R), GGATTGAAAAGAATAA CAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACA GAACTGGTATCAAAGATGAGAGAAATG; LmA105S (R), CATTTCTCTCATCTTTGATACCAGTTCTGTCAA; LmT9 4A (F), CAAGCTGGAGTCGGCGCAATATTTGA ... Lm A6 2S (R), CAGATCGATGTG AAAATGATGCAATTAGCAGTTC; Lm V123I (F), TGG CTGCTTGCGATCTATTATTCTTTTCAATCC; Lm V123I (R), GGATTGAAAAGAATAGATCGCAAGCAGCCA Screening of LmRXR mutants in tobacco protoplasts ... CTCGAGAACCATGGAAGA CGCCAAAAACATAAAG; KZKLUC1 (F), CTCGAGAA CAATGGAAGACGCCAAAAACATAAAG The bold letters in the primers show Kozak sequence The luciferase reporter gene with the Kozak sequence was then...
- 11
- 461
- 0
Báo cáo y học: "Frozen Elephant Trunk: A technique which can be offered in complex pathology to fix the whole aorta in one setting" pps
... the aorta (a. ) 3D CT reconstruction image of the thoracic aorta showing complete replacement of ascending aorta and aortic arch, the FET in the descending thoracic aorta and the saphenous vein ... All authors participated in the coordination and drafting of this text All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... achieved with the administration of custodial cardioplegia as a single dose of 2025 ml per kg, and guarantees h of myocardial ischaemia In exceptional cases of myocardial ischaemia larger than...
- 5
- 571
- 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... Table Table Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl arginine (ADMA) levels with carriage of specific alleles at ... DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine ... might therefore be an important mechanism in the haemodynamic alterations and end-organ damage observed in sepsis Notably, DDAH displays decreased activity when operating in an inflammatory milieu...
- 7
- 265
- 0
which are common used in intermediate – level english learners. and then, thesis concludes a range of verb – adverb collocations
... noun (base) can co-occur with a number of verbs (collocator) For example: a base “examination” we can have a series of verb collocators: administer/conduct/ give an/take an/fail/pass + examination ... – Adverb collocations of afford a easily, well These adverbs collocating with ‘afford’ show situation of having enough money to pay for something She can easily afford to pay for herself b In ... neatly: make something in order, neat or attractive Her red hair was carefully arranged and her face made up b alphabetically, chronologically, symmetrically, systematically A number of things...
- 52
- 330
- 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... leader, the use of formality proves to be a must in presidential speeches The 2004 inaugural address employs a rather good deal of words in their formal form as a means of attaining solemnity as ... weapons of mass destruction and maintaining the alleged link with Al Qaeda, the international network of terrorism Again, they won but bloodshed has been continuing and so far the war has claimed more ... to capture Osama bin Laden (the prime suspect behind the attacks) and many of his top aides were in vain In March 2003, the U S-led coalition attacked Iraq reasoning that Iraq was storing weapons...
- 44
- 578
- 0
Information Contained in EPA’s Regulatory Impact Analyses Can Be Made Clearer pdf
... Non-attainment Area, and Ventura County—Federal Implementation Plansc or 10 Not clearly indicated RIA for the National Emissions Standards for Hazardous Air Pollutants for Source Categories: Organic ... Guidelines and National Emissions Standards for Hazardous Air Pollutants for the Pulp, Paper, & Paperboard Industry Not clearly indicated $2 - $10 RIA for the Sacramento Non-attainment Area, South Coast ... Evaluation and Office of Air and Radiation, which has four program offices—the offices of Air Quality Planning and Standards, Mobile Sources, Atmospheric Programs, and Radiation and Indoor Air—and...
- 21
- 276
- 0
Thumbnailing for Animation Thumbnails from a sequence of Disney’s Rescuers pdf
... www.animationmeat.com Preparing for Animation: The Art of Thumbnailing The Art of Thumbnailing PDF produced by www.animationmeat.com Preparing for Animation: The Art of Thumbnailing The Art of Thumbnailing ... www.animationmeat.com Preparing for Animation: The Art of Thumbnailing The Art of Thumbnailing PDF produced by www.animationmeat.com Preparing for Animation: The Art of Thumbnailing The Art of ... www.animationmeat.com Preparing for Animation: The Art of Thumbnailing 11 The Art of Thumbnailing PDF produced by www.animationmeat.com Preparing for Animation: The Art of Thumbnailing 12 The Art...
- 35
- 475
- 2
Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf
... scales scores are transformed linearly to a 0–100 scale; for the TACQOL-PF and TACQOL-CF maximum domain scores are 16 for the emotional scales and 32 for the other scales In the calculation of ... than eight years of age In another Australian study the Royal Alexandra Hospital for Children (RAHC) Measure of Function-Clinical Rating Scale was used to evaluate QoL: 60% of survivors had normal ... focus mainly on data aggregated on the group level, for example in clinical trials, evaluative or descriptive studies Thus, all scales can be used for group comparisons in a valid and reliable way...
- 9
- 440
- 0
Báo cáo lâm nghiệp: "Stability of Norway spruce (Picea abies [L.] Karst.) stands in the Beskid Śląski and Beskid Żywiecki Mts. from the aspect of their nutrition status" pptx
... These winds gain the highest speed between November and March and can cause great damage to stands The spatial distribution of rain and snowfall in the Beskid Śląski Mts and in the western part of ... rainfall brings in considerable amounts of industrial pollution (Małek et al 2005) The research area also witnesses a periodical lack of rainfall, which may weaken the vitality of spruce and hinder ... sorptive capacity (VH) and the proportion of alkaline cations were also calculated; – the total content of C, N, S (by means of LECO CNS-2000) and of Ca, Mg, K and Na by the ASA method in organic...
- 8
- 390
- 0
Báo cáo khoa học: " Intensity modulated radiotherapy for localized prostate cancer: rigid compliance to dose-volume constraints as a warranty of acceptable toxicity?" pptx
... prostatic bed Data regarding patient clinical and staging characteristics are shown on Table At admission, all patients had a positive histologic diagnosis of prostate cancer, graded according ... (posterior) and 1.0 cm (cranial, caudal, anterior and laterals) were applied to the CTV when defining the planning target volume (PTV) All patients were treated at a Clinac 23-EX® linear accelerator ... anterior-posterior and laterals radiographs Furthermore, all patients were ordered to evacuate before and keep the bladder full during the CTSim and all the daily applications, according to a...
- 7
- 417
- 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" potx
... of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells Respir Res 2006, ... evidence of apoptosis in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial cells (SAEC) were treated with media alone (control) and various concentrations of ... red Percentage of viable (white bars), apoptotic (grey bars) and necrotic/late apoptotic (black bars) determined by counting as described in Materials and Methods Results are mean of experiments...
- 3
- 307
- 0
Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx
... after inhaled bronchodilator (short acting β2 agonist) Informed parental consent was obtained prior to performance of EB and HRCT in all cases Ethical approval was obtained to study all biopsies and ... sub-segmental airways A separate score was given to each lobe Scores ranged from to was normal wall thickness, was minimal wall thickening, was bronchial wall thickness half of the diameter of the adjacent ... bronchoalveolar lavage and EB as part of their clinical assessment in order to help confirm the diagnosis of asthma and to exclude any other associated abnormalities such as structural airway abnormalities...
- 9
- 390
- 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" pps
... target for any inhaled environmental agents and plays a critical role in the release of pro-inflammatory mediators It is also involved in the progression of tissue injury during inflammatory conditions, ... added and the rate of change in absorbance was measured for at 410 nm using a microplate reader (Bio-Rad, Hercules, CA, USA) Protein assay Protein levels were measured in the cell lysate supernatants ... in a variety of alveolar epithelial cell lines as well as in primary human small airway epithelial cells However, CSE triggered NF-κB activation and pro-inflammatory cytokine release in primary...
- 20
- 478
- 0
Báo cáo y học: " Initial distribution volume of glucose can be approximated using a conventional glucose analyzer in the intensive care unit" pot
... receiving on continuous haemodiafiltration Values are presented as mean ± standard deviation (range) or as number of patients aCatecholamines: an infusion of dopamine, dobutamine, noradrenaline, or ... plasma glucose values using the same glucose analyzer for original IDVG bUsing a conventional glucose analyzer (combined blood gas and glucose analyzer) for approximated IDVG cThe incremental ... confidence interval cose measurement system, again indicating that the methods are not interchangeable However, bearing in mind the close correlation between the two measures and the clinically applicable...
- 6
- 286
- 0
Báo cáo y học: " Alveolar recruitment can be predicted from airway pressure-lung volume loops: an experimental study in a porcine acute lung injury model" ppt
... usually a safe airway pressure and in animals with normal chest wall elastance, as in this experiment, it should generate an adequate transpulmonary pressure for obtaining accurate TLC also after ... pressure of arterial oxygen (PaO2) Materials and methods This animal interventional study was performed at the laboratory of the Clinical Institute, Aarhus University Hospital The study was approved ... monitoring of mean arterial blood pressure and for sampling of blood for analysis of PaO2, PaCO2 and pH (ABL 710; Radiometer, Copenhagen, Denmark) A central venous catheter was placed in the right internal...
- 9
- 289
- 0
An Evaluation of the book Target Pet for the first year non-English majors at Vinh University from the perspective of teachers and students
... definition of materials evaluation, the role of materials in language teaching, types and purposes of materials evaluation, materials evaluators, models and criteria for materials evaluation, and ... foundations for evaluating language teaching and learning materials are discussed, including definition of materials in language teaching and learning, the types of materials in general English ... reviewed A variety of materials evaluation such as the definition, roles and purposes of materials evaluation, types of materials evaluation, materials evaluators, models and criteria for materials...
- 110
- 1,001
- 0
Applying a variety of language games and teaching techniques in reading periods of english 10, national foreign language project 2020
... CONCLUSION In summary, to create learning motivation for the learners is one of the important factors for effective learning, especially learning foreign languages The teachers may apply a wide variety ... ice an area, wait a few hours after acupuncture before applying it You can get physical therapy, chiropractic or massage the same day you get acupuncture People who come for muscular pain and ... further information about acupuncture DO’S AND DON’TS FOR BEFORE AND AFTER ACUPUNCTURE Acupuncture is a fairly new modality and many people aren’t sure how to prepare for a treatment or what they...
- 52
- 525
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008