0

read write head on the surface of a magnetic disk

Báo cáo toán học:

Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx

Toán học

... massless Dirac cones at the K and K valleys Another essential difference is connected with spin-related properties In the surface, Hamiltonian of the 3D TI σ acts on the real spin of the charge carriers, ... In addition, changing the length of the barrier and/or the magnetic field can tune the total reflection and the perfect transmission regions We also examined the electron transmission through a ... If the incident electrons are spin polarized along the direction of the vector (π × z), the magnetic field bends the trajectory of the electrons, resulting in a rotation of the spin of the transmitted...
  • 18
  • 404
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Hóa học - Dầu khí

... influences of H on the Ag adsorption at a Si(111)-7 surface, we first calculate the adsorption energies of Ag atom at the high coordination sites on the clear and 19H-Si(111)-7 surfaces, because all the ... the main surfactant during the heteroepitaxy of the metals on Si surfaces When H interacts with Si surface- dangling bonds, this will cause the relaxation of the surface bond strain and reduce the ... adsorbed by H The charge around the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag-H bond Due to the charge transfer from the H to the Si adatom on the...
  • 6
  • 368
  • 0
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

Vật lý

... time variation of solar radiation and average temperature of the present experimental study in August and the theoretical results of [1] in June Figure 10 The time variation of solar radiation and ... time variation of the parameter “average temperature/solar radiation” for August from the present study and the published data [1] for June Figure 14 The time variation of the parameter “average ... vertical layer of water along the tank wall Part of this heat is then transferred by diffusion towards the core of the tank The water of the vertical layer becomes lighter than its surrounding and then...
  • 12
  • 520
  • 1
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Quản lý dự án

... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... interco-operation, social transformation, universal character, education The mission and corporate values summarize the corporation and the culture of all the firms belonging to it: customer satisfaction, ... will add value and establish learning as a continuous process within the organization The process of implementation of a KM strategy involves the operations of creation, storage, distribution and...
  • 10
  • 1,063
  • 1
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Báo cáo khoa học

... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... that other phenomena, such as electrostatic stabilization of the transition state, formation of covalent intermediates, steric strain, near attack conformations, substrate desolvation, low barrier...
  • 17
  • 531
  • 0
Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc

Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc

Lâm nghiệp

... Poaceae Calamus walkeri Acacia auriculiformis Musaceae Wendlandia glabrata Licuala spinosa Tarrietia javanica Cleistanthus aff myrianthus Melocalamus compactiflorus Afzelia xylocarpa Tools The future ... occurs An old cemetery is situated in the middle of an Acacia plantation, and the remains of abandoned villages can be found around the small tree forest in the village area These land features ... Animal Pahy Latin/English LUVI Pahy/English LUVI Pheo Ki re Tràm Pe A xop A ro Huen Pa lar Tu vien Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia...
  • 118
  • 556
  • 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

Điện - Điện tử

... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... aim of the national report is to review existing information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman...
  • 88
  • 581
  • 0
Báo cáo khoa học: On the mechanism of a-amylase Acarbose and cyclodextrin inhibition of barley amylase isozymes pdf

Báo cáo khoa học: On the mechanism of a-amylase Acarbose and cyclodextrin inhibition of barley amylase isozymes pdf

Báo cáo khoa học

... (e) The AMY1 concentration [E]0 was 38.8 lM decreasing to 37.3 lM by addition of acarbose A0 is the AMY1 absorbance without acarbose, A is the absorbance measured at the above acarbose concentrations ... dissociation constants In this equation, it was easier for a calculated constant to compare its value relative to zero rather than to obtain a large value When the association constant value was close ... Statistical analysis of the experimental initial rates (v) was performed using the general MichaelisMenten initial velocity equation for determination of kcat and Km and calculation of the catalytic...
  • 9
  • 437
  • 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học

... suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage increased dramatically within 12–24 h, whereas in the PR zone the ion leakage rose to a peak of  25% at 12 h and then ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra ... representative of at least three measurements under the indicated conditions (C) The relative content of OH• in the H + ParA1, A4 00 and A + ParA1 zones against the H2O zone Mean values ± standard...
  • 15
  • 479
  • 0
Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx

Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx

Báo cáo khoa học

... variant to the Kd value of the wild-type 4-kDa peptide Of the 19 alanine Table Association rate constants (ka), dissociation rate constants (kd) and dissociation constants (KD) for binding alanine ... Summary of alanine scanning of the 4-kDa peptide The results are expressed as the ratio of dissociation of the variant to that of the wild-type The amino acids mutated to alanine are designated ... coupling The 43-kDa protein solution was passed through the flow cells as an analyte Interaction of ligand and analyte was detected in real time as a change in the SPR signal The association and dissociation...
  • 10
  • 420
  • 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học

... of increasing catalase concentrations (0, 2.4, 4.8 and 7.2 lM, respectively) The effect of ventilating the reaction at the highest catalase concentration was also investigated as shown strongly ... peroxide that has escaped from the enzyme and become aquated, whilst methane oxidation may be catalysed by nonaquated hydrogen peroxide at the active site A further complication arises when one considers ... electron transfer was detected, the constant kf being the same as that observed with MMOH alone (data not shown) When an excess of catalase was added to the MMOH/ MMOB complex the current remained...
  • 6
  • 464
  • 0
effects of dimensions on the sensitivity of a conducting polymer microwire sensor

effects of dimensions on the sensitivity of a conducting polymer microwire sensor

Vật lý

... temperature The mass of air was calculated from the known volume (i.e., the volume of the chamber) and the density of air at room temperature The concentration of the methanol was calculated from the ... ratio between the mass of methanol and that of air inside the test chamber The same applied to acetone The concentrations of methanol vapor ranged from 1.3 to 6.4 ppt This range of methanol concentrations ... film Compared to a large film of flat surfaces, these small islands of the same thickness as the film have a higher surface- to-volume ratio Therefore, their SI (and consequently the SI of the inkjet-printed...
  • 9
  • 547
  • 0
Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

Báo cáo khóa học: CD38 is expressed as noncovalently associated homodimers on the surface of murine B lymphocytes doc

Báo cáo khoa học

... 5¢-(CCCTCTAGACCAGATCCTTCACGTATTAAGTC TACACG)-3¢; CD38-G68E, primer 3: 5¢-(GATGAGGC AGCGCTCGagGAAGATGTC)-3¢; CD38-G68E, primer 4: 5¢-(GGGGAATTCATGGCTAACTATGAATTTAGC CAG)-3¢ The E150L PCR product was ... CA, USA) Surface biotinylation of proteins To analyze the stability of CD38 on the plasma membrane of the different Ba/F3 mutants, labeling of the surface proteins with the membrane impermeable ... 3B), these data suggest that these domains are not obligate for the stabilization of the dimers, but rather must contribute to the overall stability of the dimers Crystallographic analysis of the...
  • 10
  • 448
  • 0
báo cáo hóa học:

báo cáo hóa học:" Unsaturated phosphatidylcholines lining on the surface of cartilage and its possible physiological roles" potx

Hóa học - Dầu khí

... interpretation of data, drafting the manuscript and acquisition of funding AO contributes to the analysis and interpretation of data, drafting the manuscript and acquisition of funding All authors have ... conception and design, the conduction of the experiment, the collection, analysis and interpretation of data, the drafting the manuscript and acquisition of funding RWC contributes to the analysis and ... phosphatidylcholine backbones It was found that the total percentage of all saturated fatty acids was about 39% and the majority of fatty acids were unsaturated fatty acids (61%) As two fatty acids...
  • 6
  • 432
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " On the solvability of a boundary value problem on the real line" pdf

Hóa học - Dầu khí

... the other required assumptions Similar considerations can be done for the p-Laplacian operator too, using Theorem 2.5 Author details Dipartimento di Matematica - Università di Bologna, Piazza ... the proof proceeds as that of Theorem 3.1, applying Theorem 2.4 instead of Theorem 2.3 □ Finally, in the case of p-Laplacian operators, the following result holds, as a consequence of Theorem ... hence the present condition (2.8) implies the validity of the analogous condition with g > 1, assumed in [11] (see condition (8)) But, on the other hand, taking g > one can lose the summability of...
  • 17
  • 409
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "On the feasibility of a channel-dependent scheduling for the SC-FDMA in 3GPP-LTE (mobile environment) based on a prioritizedbifacet Hungarian method" doc

Hóa học - Dầu khí

... polynomial is out of the scope of this research work) Page of 10 the urban area was utilized for this purpose The time delay and the corresponding average powers in the case of a 12 tap configuration ... provide the optimal resource allotment by following a fairness fashion, which means that all users were always served under a one-to-one optimal allocation scheme From the analysis of the obtained ... greater or equal than the number of zeros in a column, an horizontal line is traced The row/column traced is crossed or discarded, and the one-by-one comparison is made once again between the...
  • 10
  • 496
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Impact of LQI-Based Routing Metrics on the Performance of a One-to-One Routing Protocol for IEEE 802.15.4 Multihop Networks" docx

Hóa học - Dầu khí

... Experimental Characterization In this section we present an experimental study of the use of the LQI as an estimator of the LDR, to identify the potential advantageous and adverse characteristics of the ... distinguish the qualities of the good links of a path, and the fact that it may not take into consideration the hop count of a path 4.8 MAX-LQI and RQI In the MAX-LQI metric [21], the path with the best ... including the LQI of lost packets [19] 6.2 Variability of the LQI of a Link Figure depicts the standard deviation of the LQI against the average values of LDR (%) EURASIP Journal on Wireless Communications...
  • 20
  • 397
  • 0
Báo cáo hoa học:

Báo cáo hoa học: " On the stability of a mixed type functional equation in generalized functions" ppt

Hóa học - Dầu khí

... H-M: On the stability of an n-dimensional quadratic and additive functional equation Math Inequal Appl 9, 153–165 (2006) [12] Kannappan, Pl, Sahoo, PK: On generalizations of the Pompeiu functional ... i=1 as the equation for the spaces of generalized functions Using the fundamental solution of the heat equation, we solve the general solution and prove the Hyers– Ulam stability of this equation ... Isac, G, Rassias, ThM: Stability of Functional Equations in Several Variables Birkh¨user, Boston (1998) a [6] Jung, S-M: Hyers–Ulam–Rassias Stability of Functional Equations in Nonlinear Analysis...
  • 21
  • 299
  • 0

Xem thêm