reaction mechanism for esterification of palmitic acid and glucose in a high pressure acetone co2 system
Extraction, separation, and bio transformation of natural plant derived compounds within supercritical CO2 environment
... Candida antarctica 2002 [89] Candida antartica 2001 [90] Candida antartica Molecular Glucose Acetone; tert- Molecular Palmitic acid butanol; hexane sieves Glucose Ethyl Membrane Palmitic, stearic, ... that palm oil has a balanced fatty acid composition in which the level of saturated and unsaturated fatty acids are almost equal (50% saturated, 40% monounsaturated and 10% polyunsaturated fatty ... It was found that the initial rate reached a maximum around 16 MPa and then decreased with increasing pressure Initial rate of acylation was 12-fold higher in pure SCCO2 than in tertbutanol Increase...
- 127
- 502
- 0
Báo cáo vật lý: "Synthesis, Characterisation and Catalytic Performance of Porous Nafion Resin/Silica Nanocomposites for Esterification of Lauric Acid and Methanol" potx
... in finding new alternative solid acid catalysts for esterification that would eliminate final ester contamination and minimise effluent problems.3 Nafion resin is quickly gaining popularity for ... the acid sites in Nafion resin The esterification reaction at 75°C and R = gave rise to the best catalytic performance An increase in hydrocarbon chain length decreased the catalytic performance ... Performance The reagents used for catalytic tests were methanol (J.T Baker, 100%) and lauric acid (POFAC 1299) Esterification reactions between lauric acid and methanol were carried out in a stirred,...
- 14
- 272
- 0
Geochemistry of inorganic arsenic and selenium in a tropical soil effect of reaction time, ph, and comp
... potential groundwater and surface water contamination by these contaminants Arsenic can exist in inorganic form, organic form, and gaseous state The oxidation states of As in the natural systems are ... +3, and +5 The main inorganic forms of As in contaminated soils and sediments are +5 and +3 (Harper and Haswell, 1988) but sometimes the oxidation states of )3 and are expected to be found in highly ... soil was very acidic with pH values of about 4.5 for a soil:water ratio of 1:1 and about 4.7 for a soil:water ratio of 1:20 The parent material, weathering processes, and absence of carbonate content...
- 11
- 832
- 0
Báo cáo khoa học: "Electro-acupuncture and Chinese herbs for treatment of cervical intervertebral disk disease in a dog" potx
... sullirA irasydeH ues ilagartsA xidaR etipsoH ongiL muc airoP ealahpecorcaM sidiolytcartA amozihR gnaT iP iuG 79 eainnamheR xidaR ablA ainnoeaP xidaR sisneniS acilegnA xidaR eazihrrycylG xidaR gnesniG ... sitnecsebuP eacilegnA xidaR leahcimraC itinocA rebuT imomanniC sulumaR sitamsilA amozihR sicidaR natnuoM xetroC socoC eairoP muitorelcS inroC sutcurF eaerocsoiD amozihR ataraperP eainnamheR amozihR ... xidaR gnuoixnauhC icitsugiL amozihR ealleiruobedeL xidaR imomanniC xetroC sbreH airoP eallihporcaM eanaitneG xidaR irasA xidaR eatatnediB sihtnaryhcA xidaR eaimmocuE xetroC ihtnaroL sulumaR sitnecsebuP...
- 4
- 330
- 0
Algorithms for quality of service provisioning and enhancement in optical burst switched networks
... implementation of the signalling control path while maintaining a completely transparent optical data path for high speed data transmission It also removes the need for optical buffering, optical synchronisation ... the fact that header packets arrive at a node and are scheduled well before the actual data bursts arrive Being processed in the electronic domain, those headers can be put in a queue and easily ... formulated the load balancing problem as an optimization problem and solved it using linear integer programming For dynamic traffic demands, almost identical solution was proposed in [49, 78] For each...
- 142
- 261
- 0
báo cáo khoa học: "Four year experience of sarcoma of soft tissues and bones in a tertiary care hospital and review of literature" ppt
... Tierney JF, Stewart LA, Parmar MKB, Sarcoma Meta-analysis Collaboration: Adjuvant chemotherapy for localised resectable soft-tissue sarcoma of adults: meta-analysis of individual data Lancet 1997, ... Sarcoma, Leiomyosarcoma, Fibrosarcoma and Liposarcoma were the main subtypes of soft tissue sarcoma While for bone sarcoma, Osteosarcoma, Ewing’s sarcoma and Chondrosarcoma were the main diagnosis ... indicates for Chondrosarcoma and dashed lines depicts for Ewing’s sarcoma year recurrence free survival was 25% for Osteosarcoma, 57% for Chondrosarcoma, and 49% for Ewing’s sarcoma Leiomyosarcoma...
- 7
- 262
- 0
Báo cáo khoa học: "The concentration of oxygen, lactate and glucose in the central veins, right heart, and pulmonary artery: a study in patients with pulmonary hypertension" ppt
... measured at each sampling site as well as pulmonary artery occlusion pressure, mean arterial pressure, and cardiac index Table shows individual SO2 and [Lac] measured at each sampling site, and ... 0.86% for SO2, 0.09 mmol/l for [Lac], and 0.21 mmol/L for [Glu] Statistical analysis Analysis of variance for repeated measures was used to compare mean SO2, [Lac], and [Glu] at each sampling site ... catheter at each sampling site and the blood sampling procedure was performed within a span of min, with no changes noted in heart rate or blood pressure in any of the patients Finally, Δ[Lac]...
- 7
- 415
- 0
Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps
... WI) was amplified by PCR with primers (5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCAT TGG3' and 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc in order ... and participated in the data analysis and preparation of the manuscript SF participated in the design of the study and carried out the statistical analysis MDL participated in the preparation of ... transgene transcript Notably, many vector transgenes are complementary DNA (cDNA) copies of the natural intron-containing gene The elimination of introns is an advantageous approach for reducing of the...
- 10
- 325
- 0
Ahn and cheung the intraday patterns of the spread and depth in a market without market makers
... negatively associated with depths Spreads exhibit U-shaped intraday and intraweek patterns, and depths display reverse U-shaped intraday and intraweek patterns The negative relation between spread and ... the intraday dummy variables clearly show a U-shaped intraday variation in the spread Both the quoted and effective spreads are highest during the first half-hour of the trading session, averaging ... ŽCopeland and Galai, 1983; Glosten and Milgrom, 1985; Easley and O’Hara, 1987; Foster and Viswanathan, 1990, among others These models predict that greater information asymmetry between informed...
- 18
- 247
- 0
The dynamics of literary representation and interpretation in a multilingual environment a study of selected malaysian and singaporean novels in english
... You mayaf heard of him, perhaps?’ he rolled his head asking (157) This portrayal is more a caricature than a meaningful depiction of a character that has a role in the narrative As Sinnathurai ... introduction of words and phrases from another language In Singapore and Malaysia, Malay is often used in code-switching Chinese dialects are also used but this varies according to the dominant dialect ... seen in Sacrilege in 20 Malaya (1957) The narrative is an ironical portrayal of a Malayan rubber company and here is a tongue -in- cheek literary representation of a scene in a rubber estate: Maille...
- 249
- 440
- 0
A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy
... pregnancy There was a significant further advance of her renal disease, necessitating the initiation of haemodialysis (a kidney machine) two years later, and a living, related donor renal transplant ... remaining remarkably stable The pregnancy was complicated at 20 weeks’ gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation with heparin ... IVF in women with renal transplants, but specialists were becoming increasingly reluctant to advise women with transplants against trying for a baby, as medical care for high risk’ pregnancies...
- 6
- 512
- 0
Báo cáo khoa học: "User Expertise Modelling and Adaptivity in a Speech-based E-mail System" doc
... comprising of three main functions: navigation in the mailbox, reading of messages, and deletion of messages For ease of navigation, AthosMail makes use of automatic classification of messages ... naturalness and appropriateness of each system utterance, as well as provide any other comments that they may have on adaptation and adaptive systems All interviewees agreed on one major theme, namely ... Adaptive Information Processing for Mobile Speech Interfaces, Geneva, Switzerland Kristiina Jokinen and Graham Wilcock 2001 Adaptivity and Response Generation in a Spoken Dialogue System In van Kuppevelt,...
- 8
- 420
- 0
Báo cáo khoa học: "FOCUS AND ACCENT IN A DUTCH TEXT TO-SPEECH SYSTEM" potx
... dominating a focussed constituent are assigned the feature [+focus], while nodes dominating unfocussed material are [-focus] In order to arrive at an accentuation pattern, three rules and a well-formedness ... next assigns focus structure and w/s labelling to the sentence and outputs the predicted accent pattern A small informative text was used for evaluation of the output of the programme In this evaluation ... programme Input to this programme is a Dutch sentence; the user is asked to provide information about syntactic bracketing and labelling, and about the argument status of constituents The programme...
- 5
- 301
- 0
Báo cáo y học: "Links between maternal postpartum depressive symptoms, maternal distress, infant gender and sensitivity in a high-risk population" ppt
... developmental appropriateness of the activity) Each aspect of behaviour is evaluated separately for adults and infants The scores are then added up to generate seven scale scores For adults these are ... confirmed [19] CARE-Index The CARE-Index [9] was administered to obtain data regarding maternal sensitivity The CARE-Index is a dyadic procedure which assesses adult sensitivity in a dyadic context ... [15-17] In the Gelfand et al study [16], maternal depression accounted for as much as 38% of the variance in parental stress Page of The aim of our study was first to replicate previous research: Based...
- 7
- 271
- 0
Báo cáo y học: "Links between maternal postpartum depressive symptoms, maternal distress, infant gender and sensitivity in a high-risk population" ppsx
... participated in the design of the study and acquisition of data, performed the data analysis and drafted the manuscript PAR and TL created, and participated, in the design of the study, collected data ... increase in indirectly affected for several years after a large RTA In this study, only changes in sadness and avoidance were determined between months and years, whereas and there were only small ... minimal chronic reactions In the indirectly affected group, intrusions appeared more longstanding than avoidance and hyperarousal reactions In a 33-year follow-up of children affected by a mudslide...
- 8
- 206
- 0
Biofilm formation and control in a model drinking water distribution system with phosphorus addition
... and hydrophobic (Sutherland, 1999) They are for the formation of microbial aggregates, attachment to surfaces, structural stability and spatial arrangement of biofilm structure and serve as a ... structure and stability of biofilm, EPS serve as a protective barrier against dehydration and enhance resistance of the biofilm to harmful substances such as antimicrobial agents, and bacteriophage ... plenty of evidence that in natural, industrial and medical habitats most bacteria can be found colonizing surfaces in organized biofilm communities, rather than growing in suspension as individuals...
- 199
- 582
- 0
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps
... Songserm T, Chaisingh A, Hoonsuwan W, Buranathai C, Parakamawongsa T, Premashthira S, Amonsin A, Gilbert M, Nielen M, Stegeman A: Highly pathogenic avian influenza H5N1, Thailand, 2004 Emerg Infect ... study Name Sequencea Nucleotideb Sense 5’-TTGGTTACCATGCAAACAAYT-3’ 91-111 Antisense 5’-TRTCTTGGGCRTGTGTAACA-3 152-171 Probe 119-143 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3-3’ a Y = T or C, R = A or ... challenges for a new multilateral research endeavor Antiviral Res 2008, 78(1):64-68 25 CDC: New laboratory assay for diagnostic testing of avian influenza A/ H5 (Asian Lineage) MMWR Morb Mortal...
- 5
- 460
- 0
Tài liệu HOW TO HANDLE DIFFERENT TYPES OF RETAIL SHOPPERS AND MAKE SHOPPING A MEMORABLE EXPERIENCE FOR THEM pdf
... humble and patient to listen to their knowledgeable views Therefore instead of you doing the talking, let them speak and as soon as you get a cue that they are aware about the product/brand and are ... these regular, loyal and dedicated customers They are hooked to a particular store and don‟t need to be reminded again and again about the store STRATEGY TO HANDLE SUCH CUSTOMERS: Regular follow ... inability to understand differences among the customers and hence inability to handle them differently They use the same sales presentation, same sales tactics and same strategies with each and...
- 9
- 417
- 0
Xpert MTB/RIF test for detection of pulmonary tuberculosis and rifampicin resistance (Protocol) pptx
... missing data or clarifications All data will be entered into a database manager A draft data extraction form is included in Appendix Assessment of methodological quality Two reviewers will independently ... standard results a print out of test results Relevant clinical information Yes for all studies In this review the availability or absence of clinical information such as age and presence and severity ... clinical isolates, resistance to rifampicin has been associated with single amino acid alterations in a limited region (81 base pairs (bp) also called rifampicin-resistance determining region of...
- 23
- 505
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25