quot jugando a ganar salud quot quot playing to gain health quot a summer vacation physical activity and correct eating workshop for school aged children a pilot study
... Rosa Brancaccio, Antonella Soriani and Lidia Strigari Chapter 10 Part Intraoperative Radiotherapy for Early Breast Cancer 169 Masataka Sawaki Scope of Radiation Therapy for Specific Diseases Chapter ... respiratory-gated radiation therapy has been a major advancement in minimizing inter- and intra- fractional target variations To minimize andcorrectfor setup uncertainties and inter-fractional ... Pancreatic tumor targets usually exhibit inter-fractional motion relative to the bony anatomy because of daily variation in stomach and duodenal filling and respiratory patterns The bony anatomy...
... SsA-F SsA-R SE-Cy5 aggccttcgggttgtaaagt gttagccggtgcttcttctg FAM-aaccgcagcaattgacgttaccc-BHQ 1a tgcagaaaattgatgctgct ttgcccaggttggtaatagc JOE-acctgggtgcggtacagaaccgt-BHQ 1a ggtaaaggggcttcggtatc ... CFU/ml for S Enteritidis) Although the multiplex real-time PCR assay was demonstrated as an applicable assay in artificially inoculated meats, it needs further research for natural meat cases and ... conditions, was applied to artificially inoculated beef and Detection and quantification of Salmonella spp., Salmonella Typhimurium and Enteritidis Fig Standard curves for the multiplex real-time PCR for...
... start EEE-F TGTGCGTACCTCCTCATCGTT 335 EEE-R GACTGGCGTGAATCTCTGCTT 414 EEE-Probe HEX364 AGCAGCCTACCTTTCCGACAATGGTTGTCTAMRA WEE-F AGGGATACCCCCGAAGGTT 8220 WEE-R GTGAATAGCACACGGGTGGTT 8322 CTTTCGAATGTCACGTTCCCATGCG ... cowrote and edited the manuscript YL, H L, FL, XC, TS and GC took samples and did laboratory testing QZ and YY organized the overall project and helped edit the manuscript All the authors read and approve ... prepared One aliquot of each dilution was used for virus isolation, anda second aliquot was used for RNA extraction and duplex real-time RT-PCR analysis Table demonstrates that the duplex real-time...
... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi Aand Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ Toxicol., ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa...
... scheme and load variables much as the operator of a plant observes the behaviour of an actual plant Dynamic simulation allows for the comparison of several candidate control strategies and assesses ... that makes it easy to use and learn, yet still be applicable toa broad range of applications and users The criteria include the following: r Easy to use and learn It must have an intuitive and ... combination of hardware and software is available to implement a ‘hands-on’ approach to process control system design Engineers and students alike are now able to experiment on virtual plants that...
... so AP was a bad idea! However, in the summer of 1991 I was fortunate enough to be able to attend apilot program at the University of Iowa called the Advanced Placement Academy The Academy consisted ... BOLTS PLAN OF ACTION I Create, operate, and maintain a statewide advanced placement distance learning clearinghouse for all Wisconsin high schools The AP Consortium staff will: – Recruit AP teachers ... teachers – Arrange for their summer training at UW-Madison or Lawrence University [Appleton] – Help principals and counselors make a wide range of AP distance learning courses available to their...
... 2 A: 5b A: 6a A: 6b sin2 a cos2 a 1, A: 7a sin2 a 1 À cos 2a , A: 7b cos2 a 1 cos 2a , A: 7c eÆja cos a Æ j sin a, A: 8a ja e À eÀja , 2j A: 8b sin a A: 8c cos a ... i(t) and voltage v(t) can be considered as an analog signal x(t), thus the power of signal is proportional to the square of signal amplitude For example, if the signal x(t) is amplified by a factor ... a particular time, a set of signal values, anda set of linear equations The vector concepts can be applied to effectively describe a DSP algorithm For example, define an LÂ1 coefficient vector...
... Klein, T Ralya, B Pollak, R Obenza, and M G Harbour, A Practitioner’s Handbook for Real-Time Analysis: Guide to Rate Monotonic Analysis for Real-Time Systems Norwell, Massachusetts: Kluwer Academic ... block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade to pull, the system must allocate additional threads to allow the application to make progress ... registration, location, and actiThe CORBA Event Service model simplifies application vation; request demultiplexing; framing and error-handling; parameter marshalling and demarshalling; and operation...
... is available from Longman and the code is geared more towards visual presentation than formal precision; for example, words which qualify codes, such as "to be" in Figure 3, appear in italics and ... Similarly, choice of font can be varied for reasons of appearance and occasionally information normally associated with one field of an entry is shifted into another to create a more compact or ... a n g u a g e application such as a database query system Given a hand-coded hierarchical organization of the r e l e v a n t (central) senses of the definition vocabulary together with a classification...
... 670 to 673 h, was acquired at a slower sampling rate and is also excluded from any of our analyses.) There was a marked tendency for the period to lengthen during a circahoralian burst The last ... cellcycle-dependent and circahoralian oscillatory modes rather than to variability in the underlying circahoralian clock Indeed, the IBIs of a superposition of sine waves also vary according to the relative phases ... two waves Fast oscillations There is at least one fast oscillatory component with a period of $ which, like the circahoralian rhythm, appears, disappears and reappears at regular intervals Figure...
... policy-driven mandates will want to see that attacks are detected, incident response procedures are initiated, and log and audit trail data is generated for later analysis In addition, regulators will want ... can begin to dynamically and proactively take actions to reduce operational overhead For example, intrusion prevention rules that are not applicable to certain systems and applications in a particular ... behavior monitoring strategy for use in information security and network operations: SANS Analyst Program Real-Time Adaptive Security Traffic flow patterns and data: Many NBA products today have...
... crowdsourcing approach to sentiment annotation on in-domain political data To create a baseline sentiment model, we used Amazon Mechanical Turk (AMT) to get as varied a population of annotators as possible ... automated real-time sentiment analysis of this user-generated data can provide fast indications of changes in opinion, showing for example how an audience reacts to particular candidate’s statements ... positive and negative tweets about each candidate (right and left bars, respectively) in the last five minutes as an indicator of sentiment towards the candidates We chose to display both positive and...
... need for batch-type simulation sessions It is imperative that a dynamic simulation is ‘packaged’ in a way that makes it easy to use and learn, yet still be applicable toa broad range of applications ... were searching fora dynamic simulator that paralleled steady-state simulators being developed during the late 1960s and early 1970s Early attempts simply moved the analog toa digital formation ... sequences, and respond to failure and alarm situations More recently, training simulators have provided links toa variety of DCS platforms By using the actual control hardware to run a dynamic model...
... inadequate, if at all available In this work our aim was to design and test a RT-PCR based technique easily amenable to standardization and automation for the monitoring of cellular immune responses ... cellular immune response to vaccination against influenza virus Eight healthy donors were vaccinated against influenza virus WB specimens were obtained before vaccination (day 0) and 14–112 days afterwards ... or absence of a commercial vaccine preparation (see "materials and methods") diluted toa final concentration of influenza hemagglutinin of 0.6 μg/ml Total cellular RNA was then extracted and...
... High PBMC was evaluated Calibration standard curve and linearity of dilution Due to the lack of a standard reference material, calibration standard curves were not evaluated for quantification of ... studies Standard Operating Procedures (SOP) and assay validation plans with acceptance criteria are followed in validation studies to further assess assay performance characteristics Regulatory agencies ... Accuracy, spike and recovery, and LOQ Due to the lack of a reference standard material to establish a true value, assay accuracy, spike and recovery, and LOQ were not examined Page 14 of 25 (page number...