pollen diatom and plant macrofossil assemblages indicate a low water level phase of lake peipsi at the beginning of the holocene
báo cáo hóa học:" Health-related quality of life and physical well-being among a 63-year-old cohort of women with androgenetic alopecia; a Finnish population-based study" pot
... population Table gives the percentages and Table gives the means of the background characteristics of the women stratified into the categories of normal hair (grade and I on Ludwig's scale) and hair ... HRQOL as the dependent variables and AGA, BDI, IGR/QUICKI, marital status and education as independent variables were made The possible interactions of hair status with depression (AGA*BDI) and ... the relevance of an epidemiologic survey, and the standardized scale used by the same trained nurse as part of the clinical examination, which means that inter-rater variation was lacking We used...
- 7
- 354
- 0
Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf
... subjective and psychological well-being, meaning, flow and strengths and have developed a range of corresponding measures Based on the outstanding work of authors such as Alan Waterman, Corey ... this journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over the past decade and the demand to ... well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of “positive...
- 3
- 432
- 0
Báo cáo khoa học: "Simulated soil CO2 efflux and net ecosystem exchange in a 70-year-old Belgian Scots pine stand using the process model SECRETS" pps
... mandate necessitates both an analysis of the current standing stock of C as well as a determination, both in time and in space, of the C flux between forest vegetation and the atmosphere Stand ... despite lower than average rainfall (table VI) It appears that GPP was more limited by PAR than precipitation in 1997; soil available water, although at times reduced to 40% available, was adequate ... equations are calculated at the start of the simulation period The empirical estimate of foliage production (if present) is subtracted from the simulated estimate of daily net assimilate, along with an...
- 17
- 359
- 0
Báo cáo y học: "Different properties of ACPA and IgM-RF derived from a large dataset: further evidence of two distinct autoantibody systems" potx
... IgM-RF and markers of inflammation Discussion Characteristics of ACPA and IgM-RF were studied in a large group of RA and non-RA patients ACPA status was more stable than IgM-RF status in RA and ... Autoantibody levels in relation to markers of inflammation In RA patients, a low correlation between autoantibodies and the levels of markers of inflammation (as measured by ESR and CRP) was found ... between August 2003 and August 2007 These patients attended one of the outpatient rheumatology clinics of the Jan van Breemen Institute in the Amsterdam region of The Netherlands Each patient's final...
- 6
- 291
- 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... insecticidetreated bed nets and targeted chemoprophylaxis in a rural area of The Gambia, west Africa A review of the epidemiology and control of malaria in The Gambia, west Africa Trans R Soc Trop ... evaluate the effects of high or low birth weight as indicators of nutritional status, we categorized by birth weight above (high) or below (low) the population median, and subjected the data to analyses ... including all the molecular analyses JS participated in the field work; GM and SEM participated in drafting the manuscript All authors read and approved the final manuscript Competing interests The authors...
- 11
- 527
- 0
Báo cáo y học: "Dose-associated changes in safety and efficacy parameters observed in a 24-week maintenance trial of olanzapine long-acting injection in patients with schizophrenia" pdf
... reports the results of post hoc analyses of a 24-week maintenance study of olanzapine LAI [2] examining the potential association between olanzapine LAI dose and several safety and efficacy parameters ... Scale (PANSS) [13] total, positive, and negative scores; time to all-cause discontinuation; rate of overall discontinuation; and rate of discontinuation due to efficacy-related reasons “Efficacy-related ... designs; the collection, analysis and interpretation of data; the writing of the report; and the decision to submit the paper for publication Author details Lilly Research Laboratories, Eli Lilly and...
- 10
- 468
- 0
Báo cáo khoa học: A decade of Cdc14 – a personal perspective Delivered on 9 July 2007 at the 32nd FEBS Congress in Vienna, Austria pdf
... Cfi1/Net1 Metaphase Early anaphase Late anaphase Fig The FEAR network and the MEN control Cdc14 localization The degradation of Pds1 and hence activation of Esp1 marks the onset of anaphase Esp1 then ... They had previously shown that the key regulator of the metaphase–anaphase transition, Separase, a protease that triggers the separation of sister chromatids at the metaphase–anaphase transition ... orchestrates anaphase events At the onset of anaphase, Cdc14 is activated by the FEAR network and controls many aspects of anaphase chromosome movement The protein phosphatase promotes rDNA segregation...
- 11
- 325
- 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... ligand induced maturation of immature into mature DCs Aggarwal and Pittenger [28] also demonstrated that MSCs cause immature DCs to decrease TNF-α and mature DCs to increase IL-10 secretion Available ... On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may ... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation...
- 10
- 559
- 0
Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt
... demonstrate that both backbone and side conformations are only slightly adjusted on formation of the complex [79] The speci®c activity of AAI against insect a- amylases makes it an attractive candidate ... cysteine at a certain position was also suggested to be important Finally, the report of the structure of TMA±AAI was accompanied by an explanation of the inability of AAI to inhibit PPA [82] Amino-acid ... against mammalian a- amylases or, on the contrary, just against insect a- amylases In the latter case, this provides a highly speci®c potential weapon in plant defence a- AI2, AAI and some wheat inhibitors...
- 16
- 539
- 0
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... autoradiography DNA substrate used in this assay is a d15:d21-mer primer/ template The sequences are 5¢-ACTGGAGATCTGC AT- 3¢ and 5¢-TGAAGCATGCAGATCTCCAGT-3¢ Misincorporation assay The four template/primer ... single-stranded 75-mer (3¢-OH ends) The sequence of 75-mer oligonucleotide is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and ... in Materials and Methods, the AP site-containing strand was 3¢-end-labeled with [a- 32P]ddATP, annealed to its complementary strand and treated with human AP endonuclease to release a dRP-containing...
- 9
- 492
- 0
Báo cáo khoa học: Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf
... production of AMP from NADH, ATP and FAD (Table 3) Ninety percent of the amount of NADH used in our standard NR assay, and 60% of the amount of ATP in a GS assay, was converted into AMP within 10 at ... concentrations of ATP and NADH used in standard GS and NR assays, respectively Data are presented as mean ± SEM Cofactor AMP generated (nmol) % cofactor hydrolysed to AMP None ATP (750 nmol) NADH ... BLAST searches of sequence databases revealed that the band of 70 kDa belonged to the acyl-CoA oxidase protein family, while all of the peptides derived from the 47 and 45 kDa bands matched most...
- 7
- 457
- 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx
... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... putative signal peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... value by that for actin mRNA Fold expression change was calculated as the ratio of mRNA in the samples treated with the stress reagent to that in the untreated sample Data represent the mean ± SD...
- 12
- 348
- 0
Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot
... yielded a membranous fraction that pelleted at 40 000 g and was depleted in ATPase polypeptides as judged by SDS ⁄ PAGE analysis (Fig 4A) The absence of the ATPase complex indicates that the treatment ... appears that HL and CL treatments cause more extensive damage to the photosynthetic apparatus of the mutant plants than does LL treatment Thylakoid membranes were isolated from viridis zb63 plants ... (Eindhoven, the Netherlands) operated at 200 kV accelerating voltage in low- dose mode Images were recorded on Kodak S0163 film at a calibrated magnification of 48 600· Samples were applied to glowdischarged...
- 15
- 476
- 0
Báo cáo lâm nghiệp: " Soil and plant communities development and ecological effectiveness of reclamation on a sand mine cast" ppt
... loading rate and sawdust additions on row crop yield and nitrate leaching potentials in Virginia sand and gravel mine reclamation Land Reclamation – A Different Approach In: Proceedings 18th National ... geology, the area belongs to the Bytom Basin In general, its climate can be characterized by an annual average air temperature of 8°C and annual average precipitation of 700 mm The deposits are genetically ... Table Shannon diversity index 'H' and abundance of species (number of species) in plant communities depending on the age and category of areas in the Szczakowa sand mine cast Age of areas (years)...
- 12
- 411
- 0
Báo cáo lâm nghiệp: "Nursery fertilisation affects the frost-tolerance and plant quality of Eucalyptus globulus Labill. cuttings" ppsx
... main problems; alterations in the availability and status of water (dehydration), changes in the spatial organization of biological membranes, and a retardation of biochemical and chemical reactions ... morpho-physiological and growth parameters have been taken into account, as well as the field performance of plants one year after transplantation MATERIALS AND METHODS 2.1 Plant material Seven month-old Eucalyptus ... 0.200) The average value for all of the treatments as a whole for the numerical code was 4.88 ± 0.09 The freezing test at –7 ◦ C caused a lot of damage in all of the treatments (LD7 > 75%) and there...
- 9
- 360
- 0
Báo cáo khoa học: "Validity of leaf areas and angles estimated in a beech forest from analysis of gap frequencies, using hemispherical photographs and a plant canopy analyzer" pot
... branch level was used to estimate the total leaf area of the 26 sampled trees A relationship between the tree basal area, the height to the base of the crown and the total leaf area was established ... suggests initially averaging the gap fraction over a distance of about ten times the length of a leaf Then, the logarithms of these gap fractions are calculated and averaged over the whole transect ... logarithm of the transmission Many authors emphasize the importance of calculating K by averaging the logarithm of the transmission rather than the transmission itself [4, 14, 26] The estimate of leaf...
- 10
- 384
- 0
Báo cáo y học: "Markers of inflammation and coagulation indicate a prothrombotic state in HIV-infected patients with long-term use of antiretroviral therapy with or without abacavir" pptx
... providing an estimation of the potential to form a clot under (patho)physiological conditions The ETP was determined with a Calibrated Automated Thrombogram (CAT) The CAT assays the generation of thrombin ... http://www.aidsrestherapy.com/content/7/1/9 Page of distributed variables Categorical variables were expressed as counts and percentages Coagulation and inflammation markers were compared between patient ... thrombosis and platelet hyperreactivity have been suggested [6-9] Earlier studies focussed on markers of inflammation and coagulation before and after initiation of an ABC-containing regimen No changes...
- 7
- 274
- 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps
... potato is often associated with plant maturity, as most resistant plants are also the ones that mature the latest This is a handicap for breeders and growers who aim to get early maturing plants to ... Natural variation of potato allene oxide synthase causes differential levels of jasmonates and pathogen resistance in Arabidopsis Planta 2008, 228(2):293-306 Oberhagemann P, Chatot-Balandras C, ... juxtaposed to the last two digits of the publication year, the name of the population consensus map or of the parental map where the QTL was detected, and an Arabic number that can be followed by a letter...
- 17
- 593
- 0
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx
... regulation of Haspin and Aurora B in animals and yeast [22-24] The functions and localizations of Haspin and Aurora kinases are partly conserved in A thaliana [8,10-12,42], suggesting that functional ... plants Plant Cell 2005, 17(3):836-848 11 Kawabe A, Matsunaga S, Nakagawa K, Kurihara D, Yoneda A, Hasezawa S, Uchiyama S, Fukui K: Characterization of plant Aurora kinases during mitosis Plant Mol ... that H3S10ph and H3S28ph play a crucial role in cohesion and segregation of sister chromatids [9] In plants, AtAUR3 (Arabidopsis thaliana Aurora kinase3) phosphorylates histone H3 at Ser10 and...
- 14
- 333
- 0
báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc
... Myr:GFP was cloned by in vitro annealing of oligonucleotides Myr -A (5'-P-gatccatgggatgcttttcatgctgctgtgtggcagatgacgacaacgttggcaggaggaagaagcat-3') and Myr-B (5'-Pgatcatgcttcttcctcctgccaacgttgtcgtcatctgccacacagcagcatgaaaagcatcccatg-3') ... primer pairs; SP2 (5'-atgcgcgggcgactaaccctggagaacatg-3') and SP3 (5'-ccgagcctggaggcattctgttcaga-3') for ZmPti1b; SP7(5'-cgcaaccaccggcagccactactgacgcta-3') and SP8 (5'-taataaggtggtcacgaccgctg-3') ... At3 g17410 Arabidopsis thaliana Arabidopsis At1 g48210 thaliana Arabidopsis At2 g47060 Arabidopsis thaliana thaliana gi|51038251 Oryza sativa At1 g48220 Arabidopsis thaliana M-[GS]-C-F-[AGS]-[CFW]-C...
- 22
- 321
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25