placenta as a source of stem cells and as a key organ for fetomaternal tolerance
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... PAD, GJM and DCS analyzed data and directed Pilot Studies and Study 1; MAS treated animals, performed necropsies and supervised all animal experiments performed at ILS; EJRS and KGH treated animals, ... 5.0 d, GraphPad Software, San Diego California USA [6] If data failed Bartlett’s test for equal variances, significance was evaluated using the Kruskal-Wallis test and Dunn’s multiple comparison...
- 15
- 967
- 0
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28
... GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ACCTGCTGGGCCCACAT CAACATGAACGGACAGCTCAAC GACGGTCCATGCTCAATGGT ... CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCACTTACAGATGA 3’ Page 24 NM_024674.4 2.4 Transfection and ... TGGGCATCAGGCCAAGTC TGCAGGTCCCTTGGACATG TGGCGCCGGTTACAGAAC AAGCTGTATATTTACTCATTGAAA CAC GCCATCATCATTACCCATTGC GCCCAATACGACCAAATCC ACCCGTGGTCACCATGGTA Chapter Results 3.1 SAGE data analysis to search...
- 109
- 371
- 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"
... surface of femoral head The normal femoral head was smooth and round, and the articular cartilage was transparent and glossy (A) After freezing, the femoral head was pale in the absence of normal ... femoral head and stayed in the femoral head for a relatively long time (Figure A- F) The surface of normal femoral head was smooth and round, and the articular cartilage was transparent and glossy ... (Figure 5A) After surgery, the shape of femoral head was not markedly changed and the surface of femoral head was pale and dull without normal glossiness and smoothness The transparency was decreased...
- 10
- 584
- 0
Stem CELLS and the FUTURE OF REGENERATIVE MEDICINE pdf
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... function in damaged organs Because of the substantial biological differences between nonhuman animal and human development and between animal and human stem cells, studies with human stem cells are essential ... enhancement of treatments for disabling human diseases and injuries WHAT ARE STEM CELLS? BASIC DEFINITIONS Stem cells are unspecialized cells that can self-renew indefinitely and that can also...
- 112
- 628
- 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... GB, Page 13 of 13 Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakatta E, Abecasis GR: Genome-wide association scan shows genetic variants in the FTO gene are associated ... L, van Steensel B: Molecular maps of the reorganization of genome-nuclear lamina interactions during differentiation Mol Cell 2010, 38:603-613 83 Takahashi K, Okita K, Nakagawa M, Yamanaka S: ... dramatically expanded the catalog of genetic variants associated with some of the most common human disorders, such as various cancer types, type Page of 13 diabetes, obesity, cardiovascular disease, Crohn’s...
- 13
- 338
- 0
Báo cáo y học: "Obstructive apneas induce early activation of mesenchymal stem cells and enhancement of endothelial wound healing" ppsx
... healing assays using rat MSC and primary rat endothelial cells (10 apneic and 10 control rats for each assay) Mesenchymal stem cells The study was performed on well-characterized Lewis rat marrow ... experimentation was carried out by AC and TS Data processing and statistical analysis was undertaken by AC, TS, and JMM AC, MR, TS, JMM, and DN participated in the discussion of the results and contributed ... apneas mimicking OSA modulates basic mechanisms in the response to inflammation and endothelial damage: MSC migration and adhesion to endothelial cells and endothelial wound healing Methods Application...
- 7
- 282
- 0
Báo cáo y học: "Stem cells and repair of lung injuries" doc
... pulmonary neuroepithelial cells and bodies, innervation, and classical hematopoieticallyderived cells such as dendritic cells, mast cells, and macrophages, has hindered identification of lung stem ... lung stem cells and patterns of cell migration during tissue renewal Nevertheless, the prevailing view is that airway basal and Clara cells and alveolar type II cells serve as epithelial progenitors ... whereas elastase-induced emphysema stimulated formation of alveolar epithelium and endothelium [28] Lung injury alone, without bone marrow transplantation, may promote stem cell migration For example,...
- 9
- 273
- 0
Báo cáo y học: "Identification and isolation of embryonic stem cells in reproductive endocrinology: theoretical protocols for conservation of human embryos derived from in vitro fertilization" ppsx
... used as markers of totipotency TROMA-1 antibody (monoclonal) directed against cytokeratin-like filaments of trophectoderm and endodermal cells served as a negative marker As an additional control ... another cleaving blastomere (d), which formed a cellular aggregate on day (e) and later developed an inner cell mass-like structure (f) For all ESC colonies, alkaline phosphatase activity and Oct-4 ... Advancement of Medical Research, Association of American Universities, Juvenile Diabetes Research Foundation, and Parkinson's Action Network, as well as the Cancer Research and Prevention Foundation...
- 8
- 368
- 0
Báo cáo y học: "Deciphering the molecular machinery of stem cells: a look at the neoblast gene expression profile" pps
... planarian and (f) a planarian days after 30 Gy X-ray treatment Expression of the EST clone 32902158 (TAF-Ibeta1) in (g) an untreated planarian and (h) a planarian days after 30 Gy X-ray treatment ... Shibata N, Umesono Y, Orii H, Sakurai T, Watanabe K, Agata K: Expression of vasa(vas)-related genes in germline cells and totipotent somatic stem cells of planarians Dev Biol 1999, 206:73-87 Hayashi ... neural cells that release growth factors; radiosensitive neoblasts that activate a death process; and radiotolerant neoblasts that activate proliferation or that begin to migrate and re-populate...
- 17
- 310
- 0
Characterization of the secretion of mesenchymal stem cells and its relevance to cardioprotection
... manufacturer's instruction The primers for OCT4 were 5′-AGTGAACAGGGAATGGGTGAA-3′ and 5′-AAG CGG CAG ATG GTC GT-3′, and for SOX2 were 5′-TGAGAGAAAGAAGAGGAGAGA-3′ and 5′-TGGGGGAAAAAAAGAGAGAGG-3′ ... Cardiac Inflammation Cardiac Transformation Cardiac Damage Heart Cardiac Necrosis/Cell Death Cardiac Hypertrophy Cardiac Dysfunction Cardiac Dilation Cardiac Hemorrhaging Renal Dilation Renal ... potentially provide for a noncell-based alternative for using MSCs in treatment of cardiovascular disease (Pittenger and Martin, 2004) Noncell-based therapies as opposed to cell-based therapies are...
- 161
- 343
- 0
Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives
... form teratomas in vivo and contribute to chimeras (Takahashi and Yamanaka, 2006) Human iPSC were subsequently derived from human dermal fibroblasts using the same four factors (Takahashi et al., ... characterized by forebrain malformation and associated with mental retardation and severe craniofacial anomalies like cyclopia or proboscis formation (Ming and Muenke, 1998) The most severe form ... OCT4 and SOX2 as well as PBX1 and KLF4 (Kuroda et al., 2005; Chan et al., 2009) OCT4 (also known as POU5F1) is a member of the POU family of homeobox transcriptional factors and like NANOG, has...
- 178
- 546
- 0
Generation of porcine induced pluripotent stem cells and their differentiation into cardiac lineages
... 15g of agar was added, and the total volume was added to 1000ml The solution was then autoclaved for sterility After which, the solution was allowed to cool Ampicillin (Sigma Aldrich, A9 393) was ... media was first aspirated from the cells, and the cells were washed with 1x PBS The cells were then fixed in 4% PFA (EMS, 15710) for 10 minutes PFA was then aspirated and the cells were washed again ... Immunocytochemical Staining Gene Secondary Antibody Oct4 Alexafluor® A2 1425 SOX2 Alexafluor® A2 1430 Nanog Alexafluor® A2 1432 SSEA1 Alexafluor® A2 1426 SSEA4 Alexafluor® A2 1425 Tra-1-60 Alexafluor® A2 1426 Tra-1-81...
- 108
- 404
- 0
Neural Stem Cells and Therapy Edited by Tao Sun potx
... Masaki Warashina, Makoto Asashima and Tomoko Kuwabara Chapter 12 Noncoding RNAs in Neural Stem Cell Development 239 Shan Bian and Tao Sun Part Neural Stem Cells and Therapy 257 Chapter 13 Neural Stem/ Progenitor ... Nakayama, Hisashi Nagase, Chang-Sung Koh and Takeshi Ohkawara Chapter Role of Growth Factor Receptors in Neural Stem Cells Differentiation and Dopaminergic Neurons Generation 189 Luc a Calatrava, ... Stem Cells and Microglia as Valuable Research Tools 383 Bruno P Carreira, Maria Inês Morte, Caetana M Carvalho and Inês M Araújo Chapter 19 Immune System Modulation of Germinal and Parenchymal...
- 452
- 381
- 0
Tế bào gốc và ứng dụng trong y sinh học (Stem cells and the application in biomedicine) potx
... Shamblott, M J., et al (2001); Human embryonic germ cells derivatives express a broad range of developmentally distinct markers and proliferate extensively in vitro Proc Nat Acad Sci U S A 98, 113 - ... Dzierzak, E et al (1998); Embryonic beginnings of definitive hematopoietic stem cells Ann N Y Acad Sci 872, 256 - 262 Gallacher, L., et al (2000); Identification of novel circulating human embryonic ... embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture Dev Biol 227, 271 - 278 Beltrami, A P., et al (2001); Evidence that human cardiac myocytes...
- 14
- 757
- 2
Báo cáo hóa học: "Lasers, stem cells, and COPD" docx
... develop a therapeutic candidate that not only has a great potential for efficacy, but also can be easily implemented as part of the standard of care Our search led us to the area of low level laser ... available antiinflammatories, as well as methods of immune modulation These have served as the basis for two of our pipeline candidates, ENT-111, and ENT-894 As a commerciallyoriented organization, ... diabetic animals was performed It was demonstrated that with the He-Ne laser dosage of J/cm2 fibroblasts exhibited an enhanced migration activity, however at 16 J/cm2 activity was negated and...
- 10
- 537
- 0
Báo cáo sinh học: " No relationship between the distribution of mast cells and the survival of stage IIIB colon cancer patients" pdf
... node metastasis (MCCalnm) and in the regionaldraining lymph node without metastasis (MCC lnwm ) were evaluated as MCCstroma All evaluated section were obtained from areas far from the area of necrosis ... show that MCCalnm (the mast cell count in the normal lymph tissue adjacent to metastasis) was correlated with pathologic classifications and pathologic grades MCCalnm was higher in papillary and ... primary tumors, mast cells also infiltrate metastases The role of mast cells in metastasis is still not known Therefore, this study examined the infiltration of mast cells in lymph node metastasis...
- 6
- 468
- 0
báo cáo hóa học:" No relationship between the distribution of mast cells and the survival of stage IIIB colon cancer patients" potx
... node metastasis (MCCalnm) and in the regionaldraining lymph node without metastasis (MCC lnwm ) were evaluated as MCCstroma All evaluated section were obtained from areas far from the area of necrosis ... show that MCCalnm (the mast cell count in the normal lymph tissue adjacent to metastasis) was correlated with pathologic classifications and pathologic grades MCCalnm was higher in papillary and ... primary tumors, mast cells also infiltrate metastases The role of mast cells in metastasis is still not known Therefore, this study examined the infiltration of mast cells in lymph node metastasis...
- 6
- 360
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25