oxidative stress in alzheimers disease hippocampus a topographical study
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... Helkala EL, Laakso MP, Hanninen T, Hallikainen M,Alhainen K, Soininen H, Tuomilehto J, Nissinen A: Midlife vascularrisk factors and Alzheimer's disease in later life: longitudinal,population ... hypothesis in Alzheimer's disease. Free Radic Biol Med 1997, 23:134-147.27. Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H,Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA,Fujimoto ... findings suggest that oxidative damage ema-nating from the reactive microglia and astrocytes adjacentto senile plaques may play an early role in the pathogene-sis of AD.Several potential sources...
- 12
- 413
- 0
Tài liệu Báo cáo khoa học: Oxidative stress in the hippocampus after pilocarpineinduced status epilepticus in Wistar rats doc
... dismutase and catalase activities in the hippocampus of adult rats afterpilocarpine-induced SETable 1 shows superoxide dismutase and catalase activ-ities in the hippocampus after seizures and SE inducedby ... concentration, and super-oxide dismutase and catalase activities in the hippocampus of adult rats after SE induced by pilocarpine.ResultsBehavioral alterations after treatment withpilocarpineAccording ... several changes in variables related to the generation and elimination ofoxygen free radicals in adult rats [18,30]. An increase in free radical formation is accompanied by an imme-diate compensatory...
- 6
- 480
- 0
Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt
... CTAGCTGGTGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT5Â anking reverse GGCCGAGGAGCAGGACTGAGAATTCTTTGCGGTCTTCCTGAAGCTGACCACTGT3Â anking forward CATTGTTTGAGGCGAATTCGATATCGAGGCTCAGAACCTCCCTGCGCAGACGCG3Â anking reverse ... GGCCTCCCTAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGAACGAGzeocinpyrG forward GAATTCTCAGTCCTGCTCCTCGGCCzeocinpyrG reverse GATATCGAATTCGCCTCAAACAATGNested forward GAGACCTAGGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATATNested ... CGCTGGCGAACACATTATATGApes1E1-C1reverse ACGAATTACTTGCAGCCGCTTsidD forward ACGCAACCGACTGGTTGTTsidD reverse ATTCGTGCGAGACTCGGATCalmodulin forward CCGAGTACAAGGAAGCTTTCTCCalmodulin reverse GAATCATCTCGTCGACTTCGTCGTCAGTAspergillus...
- 16
- 361
- 0
báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx
... andabsorbance immediately read at 450 nm. Oxidized pro-tein standards, internal controls and blanks were alwaysassayed at the same time and in the same way. All sampleswere always determined ... Corresponding author AbstractBackground: An increasing body of evidence implicates both brain inflammation and oxidative stress in the pathogenesis of Alzheimer's disease (AD). The relevance ... occurs.Inflammatory mechanisms are also operative in the ADbrain and significantly contribute to the pathophysiologyof the disease. Although classical defined inflammation,including such features...
- 9
- 490
- 0
Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"
... shows activities of AS, AL and arginase in the study. AS and AL activities increased in all the three brain regions significantly in anoxia suggesting an increased utilization of citrulline ... thiobarbituric acid reactive substances and decreased total antioxidant status indicate the presence of oxidative stress in anoxia and reperfusion. The increased arginase and sustained decrease of GS activity ... may also serve as a substrate for glutamate formation and may also provide increased substrate for arginase (50). No significant changes in the activity of arginase in the anoxic group indicate...
- 8
- 622
- 0
Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf
... Ca2+paradoxParadoxical Ca2+increases were originally described in isolated heart preparations [195] and subsequentlyshown to be associated with tissue damage in this andother organs, including ... dehydrogenasecomplex in rat brain. J Comp Neurol 346, 461–479.86 Park LC, Calingasan NY, Sheu KF & Gibson GE(2000) Quantitative alpha-ketoglutarate dehydrogenaseactivity staining in brain sections ... concentration, termed‘Ca2+paradox’. The free extracellular calcium concen-tration falls dramatically in several brain disease states: (a) during or after ischemia (0.1–0.28 mm [186–189]); (b)traumatic...
- 18
- 549
- 0
Báo cáo khoa học: Pyruvate:ferredoxin oxidoreductase and bifunctional aldehyde–alcohol dehydrogenase are essential for energy metabolism under oxidative stress in Entamoeba histolytica pdf
... catalyticallyindependent domains, the N-terminal domain, display-ing ALDH activity, and the C-terminal domain, con-taining an iron-binding domain, which is involved in ADH activity. The integrity ... andpathway fluxes in live parasites.ResultsKinetic characterization of EhPFOR in amebalextractsPFORs in several anaerobic parasites have been foundattached to plasma and hydrogenosomal membranes[20,21], ... stress in Entamoeba histolyticaErika Pineda1, Rusely Encalada1, Jose´S. Rodrı´guez-Zavala1, Alfonso Olivos-Garcı´ a 2,Rafael Moreno-Sa´nchez1and Emma Saavedra11 Departamento de...
- 14
- 420
- 0
Báo cáo khoa học: Fasting-induced oxidative stress in very long chain acyl-CoA dehydrogenase-deficient mice pdf
... genesregulating peroxisomal and microsomal oxidation pathways was analyzedby RT-PCR. In addition, glutathione peroxidase and catalase activities, aswell as thiobarbituric acid reactive substances, ... aggravate hepatic damage. Furtherevidence is the significant increase in catalase activityobserved after fasting in mice fed with the MCT diet.Catalase is localized in peroxisomes, and traps ... KOmice.Catalase activitySimilar results were obtained for catalase activity, asshown in Fig. 5. With LCT and fasting, catalase activ-ity significantly increased up to 320.4 17.8 and515.8...
- 10
- 381
- 0
Báo cáo hóa học: " Oxidative stress in NSC-741909-induced apoptosis of cancer cells" potx
... E, Kisara S, Nakano S, Murata R, Tanaka Y, Sakaguchi S, Takayanagi M, Takayanagi Y, Sasaki K: Mechanism of resistance to oxidative stress in doxorubicin resistant cells. Biol Pharm Bull 2001, ... sus-tained JNK activation associated with decreased proteinlevels of MKP1, one of MAP kinase phosphatases thatinactivate JNK and p38 MAP kinases [2]. Interestingly,NSC-741909 induced an increase ... dephosphorylation through a group ofMAP kinase phosphatases [3]. MAP kinase phosphatases(MKPs) are a group of dual-specificity phosphatases thatinactivate MAPKs by dephosphorylating their threonineand...
- 10
- 576
- 0
Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx
... sense 5'-GATGTGTGGAGCACGCTTACT-3' andantisense 5'-CACAATGTCACTCCTCTCCGAATTA-3',Catalase (763 bp): sense 5'-TTACTTTCTTGTTCAGCGACCGA-3' and antisense 5'-C ACCTTCGTATAGAATGTCCGCA-3', ... ACCTTCGTATAGAATGTCCGCA-3', Cu/Zn-SOD (541 bp): sense 5'-AGGATTAACTGAAGGCGAGCATG-3' and antisense 5'-GCCCAAGTCATCTTGTTTCTCGT-3', MTH1 (169 bp): sense 5'-AGCCTCAGCGAGTCTCCTG-3' ... measure PM-induced oxidative DNA damage, singlestrand DNA breakage assay was performed according toNampalli et al.’s method [20]. Briefly, 2àg of pBR322DNA (TaKaRa, Japan) was suspended in 50àl...
- 8
- 442
- 1
Báo cáo lâm nghiệp: "Response to an ozone gradient of growth and enzymes implicated in tolerance to oxidative stress in Acer saccharum (Marsh.) seedlings" pot
... photorespiratory pathway) in Pinus taeda needles exposed to air pollution.As a shade tolerant, slow growing species [3], sugar maplehas a low assimilation rate, leading to a compromise be-tween maximizing ... repair of injured foliar tissues. As PEPC transformedPEP to OAA and as PEPC activity increased with increasingO3, the PEP availability may have decreased. Thus the amountof PEP, which is a ... thetricarboxylic acid cycle may have increased with increasingO3whereas its allocation to the shikimate pathway may havedecreased.The NR activity was decreased by more than two-fold dur-ing...
- 11
- 392
- 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx
... patients evaluated atbaseline were evaluated again after 14 days of treatmentwith nifedipine (60 mg/day) both for a cardiac study and forthe present biological evaluation. The second evaluationwas ... chlo-ramine-T equivalents.Statistical analysisData were analysed with the following nonparametric sta-tistical methods: Mann–Whitney (unpaired data) and Wil-coxon (paired data) tests for comparison ... Lemaréchal2, Ohvanesse Garabed Ekindjian2 and André Kahan11Paris V University, Department of Rheumatology A, Assistance Publique Hôpitaux de Paris, Cochin Hospital, Paris, France2Department...
- 6
- 518
- 0
Báo cáo y học: "Potential involvement of oxidative stress in cartilage senescence and development of osteoarthritis: oxidative stress induces chondrocyte telomere instability and downregulation of chondrocyte function" pptx
... dysfunction and degeneration in cartilage.The findings of the present study suggest that cumulative oxidative stress leads to a decrease in antioxidative capac-ity in articular cartilage, resulting in ... statisticallysignificant.Results Oxidative damage in human articular cartilage tissuesTo determine whether oxidative damage was present in OAdegenerated cartilage, we measured the antioxidativepotential of the intact ... chondrocytes and articular cartilage explants wereisolated from knee joints of patients undergoing arthroplasticknee surgery for OA. Oxidative damage and antioxidativecapacity in OA cartilage were investigated...
- 12
- 407
- 0
Báo cáo y học: " Impaired glucose transporter-1 degradation and increased glucose transport and oxidative stress in response to high glucose in chondrocytes from osteoarthritic versus normal human cartilag" pps
... Natsuizaka M, Ozasa M, Darmanin S, Miyamoto M, Kondo S,Kamada S, Shindoh M, Higashino F, Suhara W, Koide H, Aita K,Nakagawa K, Kondo T, Asaka M, Okada F, Kobayashi M: Syner-gistic up-regulation ... disability that affects diarthrodialjoints, being characterized by cartilage degradation, accompa-nied by local inflammation and changes in the subchondralbone. Increasing age, excessive loading ... housekeeping gene product as an inter-nal control. The intensity of the bands was analyzed usingImageQuant™ TL (GE Healthcare).Total RNA extraction and quantitative real-time RT-PCRTotal RNA was...
- 11
- 431
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25