opn can be a predictor for recurrence and prognosis of hcc patients
The a and b adapters are used as priming sites for both amplification
... more than one ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in ... and the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A magnetic field filters all DNA rich beads from empty beads, and then extracts ... adapter contains a 5’ biotin tag used for mobilization • The beads are magnetized and attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are formed...
- 19
- 390
- 0
báo cáo hóa học:"Personality and the physician-patient relationship as predictors of quality of life of cardiac patients after rehabilitation" pptx
... Julkunen and Ahlström [21] found in a large sample of patients with an increased risk of cardiovascular disease that cynicism and anger correlate with HRQOL The impact of cynicism and anger was, to a ... significant increase in explained variance for all six HRQOL scales The amount fluctuated between 1.3% and 2.9% and is thus generally greater than the increase in explanation of variance by the characteristics ... we are not aware of any study that has examined personality variables and SES in parallel for the prediction of the HRQOL after cardiac rehabilitation Studies that examine influence factors of...
- 11
- 362
- 0
Báo cáo y học: "Pre- and post-bronchodilator lung function as predictors of mortality in the Lung Health Study" pot
... 50-50, and 60 and older), and was used as a continuous variable in the survival analyses BMI was categorized at baseline and was categorized into categories ( < 25, 25-29, and >= 30 kg/m2), and was ... cancer and cardiovascular disease with comparatively fewer deaths due to non-malignant respiratory disease At baseline, the mean age of the cohort was 48.5 years and the mean FEV1 was 74.7% Of ... were sex, age, body mass index (BMI), smoking status, race, and educational status Age was classified at baseline, the year 1, and year examinations and was categorized for use in tables (35-39,...
- 22
- 359
- 0
Analysis, design and implementation of high performance control schemes for three phase PWM AC DC voltage source converter
... express my warm and sincere thanks to the laboratory officers, Mr Y C Woo, and Mr M Chandra of Electrical Machines and Drives Lab, for their readiness to help on any matter Also, I am grateful for the ... outside of the NUS campus Thanks to my old flatmates, Shen Yan, Hadja and my present flatmate Li Jie for their encouragement and help I am truely grateful to Cao Xiao, Huang Zhihong and Shao Lichun for ... Clark Transformation Matrix and Park Transformation Matrix 194 D Expressions of Average Active and Reactive Power with Symmetrical Components 197 E Hardware Components for Power Converter and...
- 286
- 738
- 0
Analysis, design and control of permanent magnet synchronous motors for wide speed operation
... Khambadkone for their help and advice Their invaluable and insightful guidance, support and encouragement inspired me in my work I am also thankful to Dr Sanjib Kumar Panda, Head of Electrical ... demagnetizing action of armature reaction and centrifugal forces and provides an asynchronous starting torque, and also acts as a damper [6] In the inset-type motors (Fig 1.3 b) permanent magnets are magnetized ... composition and reasonable accuracy The d-q model, also known as the analytical model, can be derived directly from d- and q-axis magnetic circuits or can be obtained from the three phase model of a PMSM...
- 230
- 763
- 0
Genetic engineering of hybrids of major mite allergens of dermatophagoides pteronyssinus and evaluation of their potential as vaccines for immunotherapy
... GATCAAGTCGATGTCAAAGATTGTG TCAATCGCGGATTTTAGCATGAG GAAGATAAAAAACATGATTATCAA TTAAACTTCAATCTTTTTAACACGTGC GATCCAATTCACTATGATAAAATC CTATTGGTTGTTTCGTTCCAATTC Table Primers used in the cloning of hybrid ... amplified using AFTF-DP1R and AFTF-DP7R forward and reverse primer pairs Primer AFTF DP1F DP2F DP2R DP5F DP5R DP7F DP7R Sequence ACCGGGCTTCTCCTCAACCATGGCG GAGAATGACAACATATGGATATTC GATCAAGTCGATGTCAAAGATTGTG ... immunotherapy appear to be effected at a very early stage, thresholds for the activation of mast cells and basophils appear to be modulated, leading to the desensitization of these effector cells and...
- 112
- 179
- 0
Báo cáo khoa học: "Hybrid Parsing: Using Probabilistic Models as Predictors for a Symbolic Parser" docx
... the easier attachment task and therefore provided the gold standard POS tag as part of the input data, whereas in our case pure word form sequences are analysed and POS disambiguation is part of ... lexical resources are available and because of human involvement a perfect isolation between test and training data can only be guaranteed for the probabilistic components On the other hand CoNLL restricted ... bilingual mappings have to be combined with (monolingual) language models A similar architecture has been adopted by (Wang and Harper, 2004) who train an n-best supertagger and an attachment predictor...
- 8
- 271
- 0
FINANCIAL ANALYSIS: TOOLS AND TECHNIQUES CHAPTER 10 pot
... data for a great number of earnings levels and assumptions Instead, we can exploit the direct linear relationships that exist between the quantitative factors analyzed A graphic break-even approach ... would have to be evaluated Similar analyses can be developed for other potential alternatives, always being careful to lay out cash flows and tax implications properly There are many considerations ... commercially available financial analysis and planning software described in Appendix I, has the capability to develop and display fullfledged financial analyses under different financing assumptions...
- 32
- 362
- 0
Module V Viruses and Worms.Introduction to VirusComputer viruses are perceived as a threat to potx
... the nature of attack • Draining of resources • Presence of bugs • Compatibility problems Ethical and Legal Reasons: • There are ethics and legalities that rule why virus and worms are damaging ... multitasking environment, software conflicts may occur due to sharing of data by all running programs at the same time • Th There may b damage of i f be d f information d t misplacement of d t i a ... and infect at later stages Attack Phase: • Some viruses have trigger events to activate and corrupt systems • Some viruses have bugs that replicate and perform activities like file deletion and...
- 38
- 207
- 0
Financial Analysis: Tools and Techniques Phần 10 pps
... great deal of coverage of international business and economic conditions Major U.S and Canadian dailies also carry key financial and economic data, but their coverage and emphasis vary greatly ... corporate management, analysis and announcement of new financing, and industry analysis, this information can provide a broad background for financial analysis Among the more specialized data in ... principles Earnings before interest and taxes (EBIT) An expression of a company’s earning power before the effects of financing and taxation; used in a variety of financial analyses Earnings per share...
- 51
- 349
- 0
Manual for Soil Analysis-Monitoring and Assessing Soil Bioremediation Phần 10 doc
... is affected by several parameters Water content, temperature (Blagodatskaya et al 1996), the quality of the soil organic matter (Wander 2004), as well as contaminants (e.g., Blagodatskaya and Anan’eva ... methods for the characterization of soil microbial activity and biomass Basal respiration gives information on the actual state of microbial activity in the soil After addition of an easily biodegradable ... environmental samples and since both costs and time needed are reasonable The procedure has been optimized and validated by characterizing large numbers of contaminated and uncontaminated soil samples...
- 37
- 268
- 0
Poverty Impact Analysis: Approaches and Methods - Chapter 10 pps
... GIS, and ESRI ArcView Desktop, ChartFX Graph Generator, Autodesk Map, and MapGuide 6.5 Advanced GIS Analysis Malaysia, Singapore, and Thailand also have CGE models In general, all countries can be ... the number of tariff tiers and the maximum tariff rates In particular, the program was aimed at establishing a four-tier tariff schedule, namely: a percent rate for raw materials and capital equipment ... for low tariff rates In this paper, the actual tariff rates are derived from the weighted (Q + M) average tariff rates based on the book rates calculated for each year in 1994–2000 (Manasan and...
- 64
- 296
- 0
Báo cáo y học: "Anti-Sa antibodies and antibodies against cyclic citrullinated peptide are not equivalent as predictors of severe outcomes in patients with recent-onset polyarthritis" pdf
... discrepancy between anti-CCP and anti-Sa implies hypothetical qualitative differences between the anti-Sa and the anti-CCP assays, as suggested by the moderate degree of association between antiSa and ... or less and positive anti-Sa (32, 30, and 30 patients at each visit) (triangles), and an erosion SvH score of or less and negative anti-Sa (103, 97, and 92 patients at each visit) (diamonds) ... Inova Diagnostics, San Diego, CA, USA; in accordance with the manufacturer's recommendations) Standardized radiographs of the hands and feet were obtained at inclusion and at each scheduled assessment...
- 12
- 683
- 0
Thermal Analysis - Fundamentals and Applications to Polymer Science Part 10 pot
... Dilatometry is not as widely practised as before, in part because an alternative filling agent has not been found, and has been largely supplanted by TMA Instead of the sample volume the linear ... DSC, for all scanning rates, the likelihood of radiation damage is high The sample vessel for simultaneous DSC-X-ray analysis must be made from materials of high transparency to X-rays and low ... 6.11 shows a schematic stress strain curve where a tensile force is applied at a uniform rate to a viscoelastic sample at a constant temperature The shape and characteristic parameters of the stress...
- 15
- 306
- 0
Soil and Environmental Analysis: Physical Methods - Chapter 10 docx
... resistance Soil Remolded sandy loam Remolded sandy loam Sandy loam, remolded cores and undisturbed clods Clay loam aggregates Sandy loam, undisturbed cores Sandy loam, remolded cores Parabolic probe ... rapid changes with depth However, the graphical output must then be digitized for statistical analysis, which can be laborious Digital recording has the disadvantage that maxima and minima may ... direction of travel of a slant-leg subsoiler, and below wheel tracks (O’Sullivan et al., 1987) In both of these diagrams, the arrangement of the loose and compacted regions of soil can be seen clearly...
- 27
- 427
- 0
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx
... inflammatory response, the greater the mortality rate antibiotic therapy Correlation between delta-SOFA and delayed initiation of adequate antibiotic therapy SOFA, Sequential Organ Failure Assessment ... and death was first examined by means of bivariate analysis This was accomplished using two-sample unpaired t- Page of 12 (page number not for citation purposes) Critical Care Vol 10 No Garnacho-Montero ... associations among quantitative variables with delayed initiation of adequate antibiotic therapy, a multiple linear regression analysis was performed Table Reasons for exclusion of 69 patients...
- 12
- 293
- 0
System Analysis, Design, and Development Concepts, Principles, and Practices phần 10 doc
... Establish statistical performance benchmarks via baselines, where applicable, for WHAT constitutes actual nominal system performance For example, your car’s gas mileage has a statistical mean of ... Statutory and regulatory requirements concerning environmental protection and transportation of hazardous materials (HAZMAT) are mandated by local, state, federal, and international organizations ... Focus Area 5: Perform and Maintain a “Gap” Analysis As MISSION SYSTEM and SUPPORT SYSTEM data are collected and analyzed, a repository of knowledge is established So, what you with all this data?...
- 76
- 217
- 0
Báo cáo y học: "Tiling microarray analysis of rice chromosome 10 to identify the transcriptome and relate its expression to chromosomal architecture" pptx
... to environmental changes [39,40,59] Materials and methods Plant materials and treatments Oryza sativa ssp japonica cv Nipponbare and Oryza sativa ssp indica cv 93-11 were used for all experiments ... Pandey R, Muller A, Napoli CA, Selinger DA, Pikaard CS, Richards EJ, Bender J, Mount DW, Jorgensen RA: Analysis of histone acetyltransferase and histone deacetylase families of Arabidopsis thaliana ... 3:research0029.1-0029.12 Kikuchi S, Satoh K, Nagata T, Kawagashira N, Doi K, Kishimoto N, Yazaki J, Ishikawa M, Yamada H, Ooka H, et al.: Collection, mapping, and annotation of over 28,000 cDNA clones...
- 17
- 250
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25