nmr and mutagenesis investigations of a model cis trans peptide isomerization reaction xaa sup 116 pro sup 117 of staphylococcal nuclease and its role in protein stability and folding
... used were: 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for ... transcriptase (Promega, Madison, WI, USA) For PCR of occludin variants, the primers used were: 5¢-ACTCGACAATGAACAATCCGTCAGAA-3¢ (sense) and 5¢-AGAGTATGCCATGGGACTGTCA-3¢ (antisense) for exon 5; 5¢-TGCAGG-TGCTCTTTTTGAAGGT-3¢ ... Furthermore, ina comparative analysis between OccWT and OccDE9, the exon region played a significant rolein promoting apoptosis and inhibiting invasion by regulating signaling pathways Calcium release...
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and ... interaction between VBARP and Vpr is specific The input panel represents the amount ofprotein used in this assay indicating that an equal amount ofprotein was used in all our samples and that...
... encompassing 90 families and 145 subfamilies31 In humans, a total of 518 protein kinases have been identified including 478 human eukaryotic protein kinases and 40 atypical protein kinases The protein ... domains of proteins and lipids recruits cytosolic proteins to the plasma membrane as peripheral membrane proteins 1.5.2 Membrane binding of C1 domain Donain is a region ofaprotein with a distinct ... signaling proteins and thereby change the localization state ofa large class of continuously diffusing signaling proteins322 1.5.1 Translocation of peripheral membrane proteinIn the basal state,...
... very-KIND-MAP2 interaction J Huang et al Introduction Proteinprotein interactions play important roles in the molecular recognition and functional modulation between proteins in many signal transduction ... module in v-KIND and the v-KIND-binding core module in MAP2) across a range of amino acid residues, and provided evidence that these novel proteinprotein interaction core modules play a pivotal role ... PDZ-domain-containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to...
... rather than a conformational change To assess protein stability, thermal denaturation of the proteinin presence of Cu2+ or inits absence was recorded at 210 nm (at aprotein concentration of around ... We propose that in globular proteins which bind Cu2+ specifically, the metal binding can be protective against amyloid fibril formation Therefore, maintaining correct metal ion protein interactions ... absorbance at 280 nm Acknowledgements ˇ We thank Louise Kroon Zitko and Manca Kenig for cloning and isolating the recombinant proteins We also are grateful to Sabina Rabzelj and Sasˇ a Jenko Kokalj...
... library by Nakagawa et al [15] encodes 339 amino acids specifying a 40-kDa protein (AUHp40) Western blot analysis of brain extracts consistently revealed a 32 kDa AUH proteinand it was thus assumed ... Characterisation and mitochondrial localisation of AUH, an AU-specific RNA-binding enoyl-CoA hydratase Gene 228, 85–91 Nakagawa J & Moroni C (1997) A 20-amino-acid autonomous RNA-binding domain ... was initiated to kinetically characterize AUH on its presumed natural substrate 3-MGCoA using a new strategy for its synthesis and developing a new assay In addition, a mutant form of AUH (A2 40V)...
... above Anti-(mouse rAsPPase) IgG were evaluated for AsPPase-neutralizing activity Recombinant AsPPase proteins or A suum L3 extracts were preincubated in the standard reaction mixture containing ... an XhoI (Promega) site upstream of the start codon and an antisense primer (5¢-CAGCCAA GCTTCTCACTCTTTGATGAAATGCATCT-3¢) containing a HindIII (Promega) site just downstream of amino acid residue ... The proteins were either stained using a silver staining kit (Dai-ichi Pure Chemicals) or transferred to nitrocellulose membranes (5¢-CCGAGCTCGAGACGTGAAGCGACAATCTCGC AATCT-3¢) containing an XhoI...
... behaves as an integral peroxisomal membrane proteinin Hansenula polymorpha [19] and humans [17] and as a tightly bound peripheral peroxisomal membrane protein exposed to the cytosol in Saccharomyces ... subcellular distribution of enzymes was clearly affected: part of the GAPDH (a PTS-1 protein) , ALD (a PTS-2 protein) and TIM (an I-PTS protein) is already released from the cells at concentrations of ... directs the production ofa fusion protein bearing an N-terminal extension of 20 residues including a His6-tag At a later stage, a point mutation was introduced in the vector pET2 8a- TbPEX14-N in order...
... of ultrafine protein arrays on Au nanowires arrays through the interactions of protein- mercaptoundecanoic acid and gold In this study, using a sample with aligned nanotrenches as a template, further ... Selected Values of Thermodynamics Properties of Binary Alloys Metals Park, OH: American Society for Metals; 1973 21 Xue MQ, Guo S, Zhao XS, Cao TB: Fabrication of ultrafine protein arrays on easy-fabricated ... to the AuZnδ alloy phase and the lattice misalignment of the catalytic droplets It is believed that the nanodashes filled in the nanotrenches are pure Au instead of AuZnδ alloy because a lower...
... Kitahara A, Natsume H, Yoshimi T, Horiuchi R, Nakamura H: Alterations in the enzyme activity andprotein contents ofprotein disulfide isomerase in rat tissues during fasting and refeeding Metabolism ... known, also indicates that PDI is a regulator of inflammatory cytokines Previous studies have demonstrated that proinflammatory cytokines play a critical rolein the initiation and progression of ... siRNA (100 nM) was used as a positive control for the transfection studies Statistical analysis All data were expressed as mean ± standard error and compared by one-way analysis of variance and...
... (FAK) and GTP-binding proteins Raf-1 and Rho regulated signaling pathways (Hang et al 2005) These interactions not require Ca2+ and are independent of the transamidating and GTPase activity of ... TXA2 TPα, and oxytocin receptor 2) Approximately 7% of TG2 is located in the nucleus Nuclear TG2 acts as a crosslinking enzyme, a G -protein (Singh et al 1995), andaprotein kinase As aprotein ... I-Smads), a linker region anda C-terminal MH2 domain (conserved in all Smads) The MH1 domain participates in nuclear localization, DNA-binding, andproteinprotein interactions The MH1 domain binds...
... asparagine synthase ATF activating transcription factor ATF3 activating transcription factor ATF4 activating transcription factor ATF5 activating transcription factor ATF6 activating transcription ... DNA polymerase (Stratagene) with PTK-CHOP-Luc as template strand and the following primers: sense 5’GCCACCATGGCGTATAGCGGGTGGCAGCGACAGAGCCAGAATAAC-3’, antisense 5’-ATACGCCATGGTGGCGATATAATCGACGTGTTAGAAGCTTATGCA ... Ribosomes begin translating the ATF4 mRNA at the 5’-proximal uORF1 Following translation of uORF1, a portion of the ribosomes retain the capacity to reinitiate translation at a downstream ORF During non-stressed...
... Abbreviations aa amino acid ACTH adrenocorticotropic hormone AMPK AMP-activated Protein Kinase AOX coenzyme A oxidase AP-1 adaptor protein- 1 ARF ADP ribosylation factor Arg arginine ARNO ARF nucleotide ... can be a direct binding ofa cargo protein with a motor protein dynein (Tai et al., 1999); or mediated via adaptor proteins (Nakagawa et al., 2000), or binding to a lipid domain (Noda et al., 2001) ... translation (Crowley et al., 1993) A series of covalent modifications and conformational foldings take place during and after translocation After proteins are properly processed, they are transported...
... exchange from ADP-actin to ATP-actin (Bertling et al., 2007) In addition to itsrolein regulating G-actin, Cap1 has also been shown to bind Abp1, an F-actin binding protein (Olazabal and Machesky, ... infections include the cutaneous candidiasis and two types of mucosal infections: gastrointestinal candidiasis and vaginal candidiasis Deep infections are also called invasive candidiasis, which may happen ... mammalian fibreblasts, depletion of CAP (Cap1 and Cap2) results in the accumulation of ADF/cofilin as abnormal cytoplasmic aggregates and decreased rates of both actin filament depolymerization and...
... List of Abbreviations LIST OF ABBREVIATIONS aa Amino acid AGE Acid-glycine extract Apaf-1 Apoptosis Protease Activating Factor-1 BA Blood agar BabA Blood group antigen binding adhesin BHI Brain ... acid-binding adhesin The sialic acid-binding adhesin is a 70 kDa protein that belongs to the large Hop family of H pylori outer membrane protein, including BabA sabA is found to be present in most ... (Langton and Cesareo, 1992) Catalase and superoxide dismutase are examples of antioxidant enzymes that protect the bacteria against the damaging effects of toxic oxygen metabolites (Hazell et al.,...
... 2.1.2 Maintenance of mammalian cell lines Maintenance of HeLa and A4 31 HeLa and A4 31 cells were obtained from ATCC and maintained as follows Briefly, the cells were maintained in DMEM (Sigma: D1152) ... targeting Rab22B was based on the sequence: 5’ - GTGCCTTGTGGAAATGAACTTCACA -3’ siRNA targeting GAPex-5 (or GTPaseactivating proteinand VPS9 domain-containing protein (GAPVD1)) was based on the ... the guanine nucleotide exchange factor, the GTPase activating proteinand guanine nucleotide dissociation inhibitor Once Rab proteins are bound to a membrane ofa vesicle via its lipid tail, the...
... formation in MCF7 cells 143 xiii ABBREVIATIONS 5MeC 5-methyl-cytosine 6meA 6-methyl-adenine 5AzaC 5-Aza-cytidine 5AzadC 5-Aza-deoxycytidine A. thaliana Arabidopsis thaliana aa amino acids mAb monoclonal ... genome is maintained by the coordinated interplay of functionally linked cellular pathways such as cell cycle checkpoints and DNA repair pathways 1.6.1 ATM/ATR signaling pathways Both ATM and ATR belong ... expressed in mammalian cells (Vidal and Koff, 2000), and the stability 30 of the protein is regulated by the proteosomal activator REGγ (Li et al., 2007) p21WAF1 is a short-lived proteinand changes in...
... characterization of BGT-1 BGT-1 is capable of utilizing both GABA and betaine as substrates Betaine and GABA transport are both Na+- and Cl dependent A coupling ratio of Na+/Cl/organic substrate ... mammalian brain in 1950 by Awapara et al (Awapara et al., 1950) and by Roberts and Frankel (Roberts and Frankel, 1950) In 1970’s, GABA was identified as an inhibitory neurotransmitter in the adult ... functional properties The rat GAT-1 cDNA predicts aproteinof 599 amino acids with a molecular weight of 67 kDa Hydropathy analysis reveals that GAT-1 is a single proteinof 12 transmembrane domains,...
... lead into drinking water Since PbO2 plays a critical rolein regulating lead contamination in drinking water, a precise and fast method for its detection is required to determine its abundance ... present in water supplies in coastal areas due to seawater intrusion In chlorinated drinking water, bromide can lead to the formation of brominated DBPs, such as bromoacetic acid and bromoform ... Changes in water chemistry that can alter the stabilityof PbO2 may trigger high levels of lead released from PbO2 and cause serious lead contamination in drinking water Effects of pH value and...
... studies indicating low catalytic activities in cells using standard assay conditions (Murakami et al., 2003) Thus, It is postulated that sPLA2-XIIA is incapable of liberating AA due to its weak catalytic ... involved in inflammation due to its proinflammatory stimuli-inducibility and AA releasing potential, as reported inamodelof inflammatory arthritis (Boilard et al., 2010) However, sPLA2-IIA ... possess an extra N and C-terminus, making it an unusually large 55 kDa protein that is composed of three distinct domains (Valentin et al., 200 0a) The central domain shares certain characteristics...