munteanu n 2008 important tools of setting in a novel available from lt http nina munteanu suite101 com important tools of setting in a novel 80471 ixzz1givodp00 gt 10 december 2011
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... 119 107 2850 AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt ... 11341 107 5 2839 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA ... TGAGCAAAGTCTTCAATG-3¢ and 5¢-GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT...
- 12
- 507
- 0
Báo cáo khóa học: Assembly of the silk fibroin elementary unit in endoplasmic reticulum and a role of L-chain for protection of a1,2-mannose residues in N-linked oligosaccharide chains of fibrohexamerin/P25 ppt
... blotting with biotinylated ConA (D) Fig Characterization of the transgenic silkworm line L6 · (A) Illustration of a recombinant transforming vector and normal and mutant L-chain genes (a) Arrangement ... oligosaccharide chains interact noncovalently with nascent H-chains, perhaps during their translation and translocation into ER, as a sort of molecular chaperone to prevent denaturation of H-chains ... to the normal L-chain gene (Fig 4A) Northern blot hybridization indicated that both normal L-chain mRNA and Nd-sD mutant L-chain mRNA were produced at high levels in a PSG-specific manner in the...
- 11
- 552
- 0
Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc
... 5¢-GGTGGTA GATGATCGGCAAGGTTTGC-3¢), C130S (forward 5¢CCAATTGGTGTGCTAAAGACTTTG-3¢/reverse 5¢-AA GGATAAATATGTGAGAAGATATTC-3¢), C133 (forward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/ reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), ... 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢), C159S (forward 5¢-GCCCACAATAAAGTCAATAAG AAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAG TTCTT-3¢), C176S (forward 5¢-CTCCAATTTCTGG GAAAAAAGATGGAAG- 3¢/reverse 5¢-TCAAATTTGG GCTTCCTCAATTTC-3¢) ... enzyme in vivo At least for the point mutation, localization in an incorrect subcellular compartment is unlikely to explain this finding The similar FAD binding and the absence of unspecific, large aggregates...
- 8
- 405
- 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... TTCATATGTCAGATTTGTTCAG-3¢ for N- domain+, 5¢CTGAAAACGCTAAGCATATGGGTATTACGA-3¢ for C-domain–, and 5¢-CTTGCTGATGCACATATGGGGAA AGAAAGC-3¢ for C-domain+, where underlined bases show the position of ... coli FkpA [11], these proteins are composed of N- and C-domains, which are spanned by a 40 amino acid long a3 helix The N- domain consists of a1 and a2 helices and an N- terminal region of a3 helix ... L, Tutino ML, Fontanella B, Gerday C, Mainolfi K, Pascarella S, Sannia G, Vinci F & Marino G (2000) Aspartate aminotransferase from the Antarctic bacterium Pseudoalteromonas haloplanktis TAC 125...
- 11
- 332
- 0
Báo cáo khoa học: The N-acetylglutamate synthase/N-acetylglutamate kinase metabolon of Saccharomyces cerevisiae allows co-ordinated feedback regulation of the first two steps in arginine biosynthesis potx
... CCTGATCATAG HP80 ¼ CTATGATCAGGAGAGG TTACAAATTAGTTGAAAATTTTGTGAAGTCGTG GTG HP81 ¼ CACTAATTTGTAACCTCTCCTGAT AACCTCTCTTTTTGTGCTGATATTG HP82 ¼ CAA TATCAGCACAAAAAGAGAGGTTATCAGGAGAG GTTACAAATTAGTG AA29 ... ATGATGATGATGATGATGTGAAATATTTTTTTCA TTTTCCCAAC K10 ¼ CCGGAAGCTTTCAGACAC CAATAATTTTATTTTCAGGG K12 ¼ CCGGAAG CTTGTGAGCGGATAACAATTTCACACAGGAAAC AGACCATGCCTCGTCCCGAGGGAGTTAACACC Plasmid constructs Table ... contain equal amounts of total protein (C) Lanes and contain 7.5 lg total protein, lanes and contain 15 lg, and lanes and contain 30 lg MM is the molecular mass standard expressed and to be stable...
- 11
- 313
- 0
Báo cáo khóa học: Determination of modulation of ligand properties of synthetic complex-type biantennary N-glycans by introduction of bisecting GlcNAc in silico, in vitro and in vivo pot
... an ensuing decrease in affinity in plant lectin binding can help to explain the new cell feature In the same way, it is reasonable to suggest galectin-1 and galectin-3 as candidates to rationalize ... ÔbisectingÕ N- acetylglucosaminyl group on the binding of biantennary, complex oligosaccharides to concanavalin A, Phaseolus vulgaris erythroagglutinin (E-PHA), and Ricinus communis agglutinin (RCA-120) ... · · · 101 0 101 0 101 0 101 0 101 0 101 0 101 0 101 0 101 0 From [37] N- glycans [37] in Table The general conclusion is that the presence of a bisecting GlcNAc affects lectin affinity In the case of mistletoe...
- 17
- 481
- 0
Báo cáo toán học: "n the non–existence of certain hyperovals in dual Andr´ planes of order 22h e" pot
... has at most q points; in particular any oval which arises from a hyperoval of AG(2, q ) by deleting a point cannot be an oval of MU (q ) For an actual example of a q –arc of MU (q ) coming from ... existence of inherited ovals in the dual plane of H(q ), which is a Moulton plane M (q ) of the same order Moulton planes have been originally introduced in [10] , by altering some of the lines of a ... If an arc A of P G(2, q ) is in turn an arc in MU (q ) then, A is an inherited arc of MU (q ) Any hyperoval of the Desarguesian projective plane P G(2, q ) obtained from a conic by adding its nucleus...
- 5
- 179
- 0
Báo cáo toán học: "Extremal subsets of {1, ..., n} avoiding solutions to linear equations in three variables" doc
... b already located in Ac via the pairing arising from (7) Since it suffices at this point to locate just one extra element in Ac we may for the remainder of this argument assume that b ≥ and that ... our initial observations also apply in the inhomogeneous setting We shall also employ the concise formulation A avoids L’ to indicate that a set A of positive integers contains no solutions to ... that |B| ≤ |An |, as desired Thus we may assume that B contains no multiples of b in the interval ( bn , 2bn ] If B c c contains no multiples of b at all in the range [1, 2bn ], then trivially...
- 22
- 348
- 0
báo cáo khoa học: "First-in-class, first-in-human phase I results of targeted agents: Highlights of the 2008 American Society of Clinical Oncology meeting" pot
... contributions AM collected and assembled the data, and participated in conception and design, data analysis and interpretation, and manuscript writing LS participated in conception and design, data analysis ... first -in- human agents entering the clinical arena is a further confirmation of this phenomenon Competing interests Monitoring of downstream pathways of drug targets was also presented for many of ... immunity Phase II studies are being planned in pancreatic cancer (combined with gemcitabine), and in combination with chemotherapy in melanoma patients Discussion Phase I trials of targeted agents represent...
- 9
- 539
- 0
Báo cáo y học: "Combination of lung ultrasound (a comet-tail sign) and N-terminal pro-brain natriuretic peptide in differentiating acute heart failure from chronic obstructive pulmonary disease and asthma as cause of acute dyspnea in prehospital emergency
... diagnostic accuracy Furthermore, the combination of ultrasound examination and Table Test characteristics of ultrasound examination, modified Boston examination, NT-proBNP and combination of ultrasound ... prehospital settings Conclusions Ultrasound examination of the lungs alone or in combination with NT-proBNP testing has high diagnostic accuracy in differentiating acute HF-related from COPD/asthma-related ... utility of ultrasound examination and NT-proBNP in a prehospital setting Statistical analysis Univariate comparisons were made by using the c2 test for categorical variables and an unpaired t-test...
- 9
- 243
- 0
Role of misfolded nuclear receptor co repressor (n cor) induced transcriptional de regulation in the pathogenesis of acute monocytic leukemia (AML m5
... Identification of new therapeutics such as new nucleoside analogues (Fludarabine, Cladribine, Cyclopentenyl, Cytosine and Clofarabine) and monoclonal antibodies against CD33 labeled with radionuclide ... modifications may result in changes of the folding process causing protein misfolding65 In a normal mammalian cell system, the amino acid sequence in the polypeptide chain contains all the necessary ... wonderful lab mates past and present, Angela, Jek, Chai Peng, Hannah, Norlizan, Angie, Li Feng, Leo, Wai Kay, Su Yin, Jayne, Jess, Fen Yee, Wanqiu, Yan Kun and Meg for their companionship and assistance...
- 227
- 312
- 0
The role of the n terminal extension domain of vamp4 in the regulation of its recycling to the TRANS GOLGI network
... List of mammalian SNAREs Name Syntaxin Syntaxin Syntaxin Syntaxin Syntaxin Syntaxin Syntaxin Syntaxin Syntaxin 10 Syntaxin 11 Syntaxin 13 Syntaxin 16 Syntaxin 17 Syntaxin 18 Syntaxin 19 Syntaxin ... preceding N- terminal domain Habc with preceding N- terminal domain Habc Habc with preceding N- terminal domain Habc Habc Habc with preceding N- terminal domain Habc with preceding N- terminal domain Habc ... biotinylation and analysis 67 2 .10 Internalization assay 68 2 .10. 1 Continuous internalization of antibodies and/or ligands 68 2 .10. 2 Discontinuous internalization of antibodies 68 Inhibition of...
- 232
- 485
- 0
Tình hình thực hiện chế độ hưu trí tại huyện Thọ Xuân tỉnh Thanh Hóa giai đoạn 2003-2008
... th n và gia đình qua quá trình lao đô ̣ng Quá trình này diê n các nhà máy, xí nghiê ̣p, đ n vi ̣ kinh tế , quan hành chính sự nghiê ̣p, hoă ̣c ngoài quố c doanh Trong quá trình ... ATM Ng n hàng Đông Á, Ng n hàng đầu tư phát tri n Việt Nam, ng n hàng Ngoại thương Việt Nam ch a có chi nhánh huy n Thêm vào đó, ng n hàng n ng nghiệp phát tri n nông th n chi nhánh Thọ Xu n có ... việc ứng dụng công nghệ thông tin qu n lý BHXH v a mục tiêu, nhiệm vụ v a động lực để c n nh n vi n không ngừng học hỏi, n ng cao trình độ chuy n m n khả ứng dụng công nghệ thông tin B n cạnh đó,...
- 41
- 361
- 0
Tình hình thực hiện chế độ hưu trí tại huyện Thọ Xuân tỉnh Thanh Hóa giai đoạn 2003-2008
... v a mục tiêu, nhiệm vụ v a động lực để c n nh n vi n 30 không ngừng học hỏi, n ng cao trình độ chuy n m n khả ứng dụng công nghệ thông tin B n cạnh đó, ứng dụng mạng LAN n i quan, BHXH huy n ... vững an toà n xã hộ i và ô n định xã hộ i, đ a đất n ớc ngà y cà ng phá t triể n theo hướng d n già u, n ớc mạ nh, xã hội công bằ ng, d n chủ, v n minh Trong giai đoạ n ... độ BHXH người lao động - Hệ thống ng n hàng huy n ch a phát tri n Hi n đ a b n huy n có chi nhánh Ng n hàng n ng nghiệp phát tri n nông th n, Ng n hàng sách Các ng n hàng khác cung ứng dịch vụ...
- 40
- 447
- 3
Tài liệu Báo cáo tài chính 2008 Công ty Cổ phần in sách giáo khoa tại Thành phố Hà Nội docx
... Chức vụ Ông Nguy n Minh Khang Chủ tịch Ông Lê Hồng Quế Uỷ vi n Ông Nguy n Quang Ti n Uỷ vi n Ông Nguy n V n Đạt Uỷ vi n Ông Dương Xu n Mộc Uỷ vi n (bổ nhiệm ngày 15/4 /2008) Các thành vi n Ban Giám ... T n Chức vụ Bà Nguy n V n Anh Ông Nguy n Đắc Hu n Ông Lê Quang Hà Bà Phan Thị Thu Hà Bà Lã Thị V n Anh Trưởng ban (bổ nhiệm ngày 15/4 /2008) Uỷ vi n (bổ nhiệm ngày 15/4 /2008) Uỷ vi n (bổ nhiệm ngày ... xuất Ngành nghề kinh doanh Công ty hoạt động theo Giấy chứng nh n đăng ký kinh doanh Sở kế hoạch Đầu tư Thành phố Hà N i cấp với ngành nghề kinh doanh sau: • • S n xuất kinh doanh loại s n phẩm:...
- 22
- 319
- 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... N- acylsulfonamide-linked dinucleoside inhibitors of RNase A [1], and has numerous interesting homologs [24] In humans, angiogenin (RNase 5) is an inducer of neovascularization, and plays an important ... and hence cannot accommodate an electronegative atom In contrast, the exocyclic N6 -amino group of adenine forms a hydrogen bond with the side chain of Asn71, increasing the afnity of RNase A ... analogs containing sulfonate and sulfonamide internucleoside linkages Patent 5561225, 112 30 Fisher BM, Ha J-H & Raines RT (1998) Coulombic forces in proteinRNA interactions: binding and cleavage...
- 9
- 626
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
- 9
- 414
- 0
CREDIT CARDHOLDERS’ BILL OF RIGHTS ACT OF 2008: Mr. FRANK of Massachusetts, from the Committee on Financial Services, submitted the following ppt
... ‘‘(I) incurred a finance charge in each month of the semiannual period on any portion of an outstanding balance on which a finance charge had not previously been incurred; and ‘‘(II) incurred any ... charge in each month of the semiannual period on any portion of an outstanding balance on which a finance charge had not previously been incurred; and (II) incurred any such finance charge at any ... elect, in any case described in such paragraph, to allocate more than a pro rata share of any payment to a portion of the outstanding balance that bears a higher annual percentage rate than another...
- 33
- 384
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25