modeling measurement and evaluation of spindle radial errors in a miniaturized machine tool
John wiley sons qos measurement and evaluation of telecommunications quality of service (2001)
... depending on how the data are acquired For example, if the data source is an existing database that has been created by someone else and is regularly maintained, and that database has been examined ... most basic data extraction and manipulation functions, such as filtering against simple criteria and calculation of common statistics, such as averages The Analysis Process 36 and standard deviations ... queried for welldefined subsets of the data; and † Data manipulation To clean up data sets, quantify measures, and facilitate understanding of the variations in values of quantifiers under different...
- 245
- 483
- 0
Export Performance Measurement: An Evaluation of the Empirical Research in the Literature pdf
... (2002) Balabanis and Katsikea (2003) O'Cass and Julian (2003) Cadogan, Cui, and Li (2003) Dhanaraj and Beamish (2003) Akyol and Akehurst (2003) Morgan, Kaleka, and Katsikeas (2004) Lages and Lages ... marketing and international business, including Journal of Marketing, Journal of International Marketing, Journal of International Business Studies, Journal of Business Research, Management International ... INTRODUCTION The area of export performance is attracting both academic and managerial attention at an increasing pace The fact that globalization has become an undisputed reality has led an increasing number...
- 23
- 1,054
- 0
Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx
... the Assabet River Basin, eastern Massachusetts Fine to coarse sand and gravel Silt and clay Sand and gravel Medium to coarse sand and gravel Sand and gravel Fine to coarse sand and gravel AN-11G ... Alternatives in the Assabet River Basin, Eastern MA Table Drainage-area characteristics and mean annual flows at streamflow-gaging stations in and near the Assabet River Basin, eastern Massachusetts ... location at 42°22′01″ latitude and 71°35′47″ longitude Fine to coarse sand and gravel Fine to coarse sand and gravel Sand and gravel Sand and gravel AN-06G AN-05G AN-09G AN-10G Well site Predominant...
- 142
- 1,437
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... works in Windows 95 and above NorthStar is an integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating ... what and how of measuring baseline performance defined as the measurement of actual clinical practice and its comparison to desired clinical practice (Measuring Baseline Performance) NorthStar ... Critically appraise clinical guidelines Measure baseline performance (defined as the measurement of actual clinical practice and its comparison to desired clinical practice) Identify determinants of...
- 7
- 429
- 0
báo cáo khoa học: " Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data" potx
... GGGTGAAAGGGTTTCCAAAT GATCCTTGTGGAGGAGTGGA/ GCGAAACAGTTCGACGAGAT *GhMZA DT571956 At5g46630 Clathrin adaptor complexes medium subunit family protein 1.40E-131 82% 1853 755 CCGTCAGACAGATTGGAGGT/ AAAGCAACAGCCTCAACGAC ... DW505546 At4g02890 Polyubiquitin 0.0 80% 1502 510 CAACGCTCCATCTTGTCCTT/ TGATCGTCTTTCCCGTAAGC GhMADS3 ES812912 At4G18960 AGAMOUS NA NA NA NA ATCAAGCGGATCGAAAACAC/ CAACCTCAGCGTCACAAAGA GhSEP-like1 ... *GhPP 2A1 DT545658 At1g59830 Catalytic subunit of protein phosphatase 2A 3.30E-110 77% 1301 675 TTGCAGACCGTATGAGCAAG/ ATCCTCCGATCCAGACACTG TCCCCATCTCTGGTTTTGAG/ CTTGGGCTCATTGATCTGGT TGCCTGCAGTAAATCTGTGC/...
- 12
- 390
- 0
research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam
... implementation, CSR reporting of CSR in a multinational company operating in Vietnam by asking respondents‟ understanding and opinion From conducting research, it can show the understanding and awareness ... can thereby have an inclusive financial, commercial and social approach, leading to a long term and strategy minimizing risks linked to uncertainly 1.1.3 CSR in multinational companies operating ... overarching context is…sustainability: both sustainability of the 26 organization itself (the interrelation of the social, the environmental, the cultural and the financial) and sustainability of...
- 73
- 705
- 2
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... performing basic translations, but also for establishing and maintaining social relationships In addition, Chaney (1998:13) indicates that speaking is the process of building 16 and sharing meaning ... attitude of students and teachers toward English teaching and learning in general and a speaking lesson in particular To get more information about the situation of teaching speaking skill in 9th ... attractive than the others because it attracts a lot of participants in a class and makes a class more interesting” a student said Playing games gives students relaxing times and way to understand...
- 119
- 525
- 1
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot
... Developing a natural language interface to complex data ACM Tr(uts on D=t~bsse ~l/stsrrts, (1978), 2, pp 105-147 I BaUard, B A "Domain Class" approach to transportable natural language processing ... language question answering system for a large relational database Cowzm A C M 21 (1978), 7, pp 526-539 22 Woods, W Semantics and quantification in natural language question answering In Advances ... phrase-structured grammatical formalism for transportable natural language processing, llm~r J Cow~p~t~zt~na~ L~n~ist~cs, to appear 24 Ginsparg, J A robust portable natural language data b a s...
- 5
- 452
- 0
báo cáo sinh học:" Factors affecting recruitment and retention of community health workers in a newborn care intervention in Bangladesh" pptx
... Ahmed, Saifuddin Ahmed, Ashraful Alam, Nabeel Ashraf Ali, Ahmed Al-Kabir, Arif Billah AlMahmud, Ahmed Al-Sabir, Tariq Anwar, Abdullah H Baqui, Nazma Begum, Robert E Black, Atique Iqbal Chowdhury, ... Mohiuddin Chowdhury, Sameena Chow- dhury, Gary L Darmstadt, Milan Krishna Das, Shams El-Arifeen, Zafar Ahmad Hakim, A. K.M Fazlul Haque, Quamrul Hasan, Daniel Hossain, Shahla Khatun, Paul Law, Amnesty ... Ishtiaq Mannan, Qazi Sadequr Rahman, Syed Moshfiqur Rahman, Samir K Saha, Mathuram Santosham, Habibur Rahman Seraji, Rasheduzzaman Shah, Ashrafuddin Siddik, Uzma Syed, Hugh Waters, Emma K Williams,...
- 14
- 449
- 1
Báo cáo y học: "Early recognition and treatment of non-traumatic shock in a community hospital" pot
... hypovolemia, sepsis, cardiac pump dysfunction, and anaphylaxis Shock is a common cause of morbidity and mortality Septic shock, for instance, is the 10th leading cause of death in the United States, and ... experience, and skills of care providers operating in a system that was not necessarily designed with speed in mind In the current study, Sebat and colleagues investigated whether a systems-based team approach ... health care providers completed a standardized teaching package that included a 1-hour slide presentation and subsequent interactive classes Upon implementation, a dedicated ICU bed was kept available...
- 3
- 139
- 0
Báo cáo y học: " Estimation and correction of non-specific binding in a large-scale spike-in experiment" pot
... based on log values, to reduce the dynamic range of the observations This version of the Naef model contains 77 parameters (2 scaling parameters a and b, and affinities for A, C and G for each ... specific binding signal and correcting for chemical saturation, which require additional large-scale datasets in which the concentration of every transcript is known Materials and methods Mapping of ... A single C and S sample was generated and an aliquot from each sample was used to create each replicate, and technical variation in the methods to generate each hybridization could result in...
- 19
- 274
- 0
DSpace at VNU: The Formation and Stabilization of Aerobic Granular Sludge in a Sequencing Batch Airlift Reactor for Treating Tapioca-Processing Wastewater
... 14-16], and some attempts have applied aerobic granular sludge in practical wastewater treatment for treating pollutants in domestic wastewater [17], municipal wastewater [7], and industrial wastewater ... wastewater was measured in terms of removal efficiency of COD, nitrogen, and phosphorus Table Characterization of raw tapioca-processing wastewater Parameters Unit Values Vietnamese standard of ... KHOKHLACHEV N., KALENOV S., ZANINA O., TYUPA D., BAURINA M., KUZNETSOV A The role of stress agents as operating factors in formation and functioning of granular aerobic activated sludge at model...
- 8
- 141
- 0
Reliability modeling and evaluation of sulaimani erbil electrical power system
... forced and scheduled outages are take into account Name of the line Dokan-asluja Tasluja-Rizgari Dokan-Azadi Dokan-N.E Azadi-N.E Tasluja-Azmer Azmer-Rizgari Derbandikhan-Rizgar i Derbandikhan-Azmer ... 0.991093988 Name of the line Dokan-asluja Tasluja-Rizgari Dokan-Azadi Dokan-N.E Azadi-N.E Tasluja-Azmer Azmer-Rizgari Derbandikhan-Rizgari Derbandikhan-Azmer Table Continue Calculated Reliability index ... Laws: a) a + a = b) a × a = 5-Idempotent Laws: a) a + a = a b) a × a = a 6-Boundedness Laws: a) a + = b) a × = 7-Absorption Laws: a) a + ( a × b ) = a b) a × ( a + b ) = a 8-Associative Laws:...
- 9
- 608
- 0
Modeling and evaluation of trusts in multi agent systems
... trustworthiness of strangers we meet • Propagated Reputation: In a Multi-agent System, an agent might be a stranger to the evaluating agent, and the evaluating agent can attempt to estimate the stranger’s ... can be classified into categories [Suryanarayana, et al., 2004], which are credential and policy-based trust management, reputation-based trust management and social network-based trust management ... credentials pertaining to a specific party [Donovan and Yolanda, 2006] have pointed out that a credential may be as simple as a signature uniquely identifying an entity, or as complex and non-specific...
- 113
- 320
- 0
Thermodynamic modeling and evaluation of high efficiency heat pipe integrated biomass GasifiereSolid Oxide Fuel CellseGas Turbine systems
... et al / Energy 109 (2016) 751e764 753 Table Summary of the main advantages and challenges of the different gasifying principles Gaisfying agent Air Steam Carbon dioxide Main advantages Main technical ... gasifier and it is cleaned using a set of high temperature gas cleaning devices Clean biosyngas is fed to the SOFC which operates at an average temperature of 950 C, and part of the anode and ... temperature at the anode and cathode of the SOFC unit was fixed at 1000 C Part of the anode and cathode streams is recirculated Later on, a part of the anode off gas was supplied to the gasifier as...
- 14
- 197
- 0
IMPROVING INFORMATION SYSTEM SUPPORTING MONITORING AND EVALUATION OF GREATER MEKONG SUBREGION SUSTAINABLE TOURISM DEVELOPMENT PROJECT IN VIET NAM
... Monitoring & Evaluation MPI Ministry of Planning and Investment MOF Ministry of Finance MBA Master of Business Administration VLAP Viet Nam Land Administration Project WB World Bank Sustainable ... mechanism M&E frame Information demand and indicators Project starting Requirements on baseline data Data recording and aggreagting Aggregated in database or worksheet M&E implementation Analysis ... can understand and use” (1,p7) Information are “data that have been shaped into a form that is meaningful and useful to human being” (1,p7) An Information system can be defined as a set of interrelated...
- 114
- 653
- 2
Modeling, Measurement and Control P18
... nontoxic materials (amino acids) into a microstructure that contains a continuous network of members in tension (amorphous strains) and a discontinuous set of members in compression (the β-pleated ... generalized coordinates and an independent set of the tendon and rod vectors forming l All remaining tendon vectors may be written as a linear combination of l This relation will now be established The ... equilibria is in a separate paper.27 Damping strategies for controlled tensegrity structures are a subject of further research The example case given in Appendix 18.D was coded in Matlab and simulated...
- 62
- 365
- 0
Modeling, Measurement and Control P21
... mentioned gearing (spur and helical) is applied if the input and output rotation have parallel axes If the axes are not parallel, then bevel gearing may be applied An example of bevel gearing in a robot ... weight and often introduces backlash So-called zero-backlash models are rather expensive Note that buying a motor and a gearbox already attached to it and considering this assembly as one unit are ... kinds of leakage, internal and external, as shown in Figure 21.11 If the coefficient of internal leakage is ci and that of the external is ce, and if the coefficient of total leakage is defined as...
- 34
- 359
- 0
Modeling, Measurement and Control P23
... provide a simple and effective solution that permits fast and easy interfacing of mechanical parts in spite of initial positioning errors The main advantage is that a simple positional controller can ... (rate linearization) during contact, and assuming the gravitational effect to be ideally compensated for, we obtain a linearized model around a nominal trajectory in Cartesian space x in the ... workpiece (Figure 23.5) A crucial feature of the RCC is that it consists of translational and rotational parts; this combination allows lateral and angular errors to be accommodated independently RCC...
- 52
- 391
- 0
Modeling, Measurement and Control P24
... advanced robot control loops as learning and compensation elements using nonlinear mapping, learning, parallel processing, self-organizing, and generalization Usually, learning and control in ... list of path nodes Each of path nodes, apart from the pointer to the next node, consists of x and y coordinates of an intermediate knot point along the path, and a Boolean variable b indicating ... example is application of GA to PD local gain tuning and determination of nominal trajectory for dynamic biped walking Designs to achieve different goals, such as being able to walk on an inclined...
- 46
- 341
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25