microglia enhanced the clearance of a synuclein aggregates in the mesocortex of patients with lewy body disease
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... isolated from the brains of infected animals (Figure 3B) in the absence of significant increases in levels of this viral sensor in total brain protein isolates (Figure 3A) Finally, we assessed the ... Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, Taipei, Taiwan) for 24 hours at 4°C, blots were washed and incubated in the presence of an horseradish ... Protein isolates were prepared and analyzed for the presence of DAI, STING, RIP3, and viral gG1 by immunoblot analysis In vitro stimulation of microglia and astrocytes with the DAI ligand, B-DNA...
- 12
- 529
- 0
Báo cáo toán học: " Synthesis and anti-HSV-1 evaluation of new " docx
... (silica gel) All chemicals were reagent grade High-resolution mass spectral analysis was recorded using a Finingan MAT 71 1A General procedures naphthyridine for derivatives the synthesis ( 1a k), and ... NIV, Azevedo AR, Pinheiro LCS, Souza TML, Giongo V, Passamani F, Magalhães UO, Albuquerque MG, Cabral LM, Rodrigues CR (2008) SAR of a series of anti-HSV-1 acridone derivatives, and a rational acridone-based ... was poured into 50 mL of ice-water The precipitated was filtered, dried, and recrystallized from a mixture of ethanol and water The compounds obtained 5a k and 6a c were reacted with 10 mL NaOH...
- 24
- 433
- 0
Đáp án đề thi thử đại học toán khối A- lần 1 - THPT Nga Sơn
... S A B I I IV D A C H D K B H C Hạ IH ⊥ BC , gọi K trung điểm AB 1 a2 S ABCD = ( AB + CD ) AD = 3a ; S ABI = AB AI = a ; S DCI = DC.DI = Có suy 2 2 3a Mặt khác BC = BK + KC = a nên S BIC = S ABCD ... VI.b A1 B1 ⊥ IO A2 B2 ⊥ IO Mặt khác ; đồng thời A1 B1 = A2 B2 = •) AB ≡ A1 B1 có phương trình x + y − = •) AB ≡ A2 B2 có phương trình x + y + = AB ⊥ IO nên AB = 3 ... IH · · ⇒ BC ⊥ SH ⇒ 600 = ( SBC ; ABCD) = SHI ⇒ SI = IH tan 600 = 3a 15 BC ⊥ SI Vậy VS ABCD V 0,50 0,50 1 3a 15 3a 15 = SI S ABCD = 3a = 3 5 x − x − x + m = m (*) Đặt t = x + m (1) (t ≥ 0)...
- 6
- 315
- 0
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot
... was obtained tag-free through purification in a batch procedure using the glutathione-S-transferase-tag purification kit; the recombinant protein remained in the supernatant The purity of the material ... separated by SDS/PAGE After transfer, the blot was incubated with mAb-aTyr and then with a labeled secondary antibody The results show that in the absence of curdlan no bands were detected on the ... also undergoes processing during incubation with curdlan, an antibody was raised against the recombinant sponge protein This antibody was used to determine the size of the mature peptide in the...
- 14
- 299
- 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
... significant matches to several ESTs in the databases The novel gene was termed nicolin (NICN1) A BLAST search against the ESTdatabase with the NICN1 cDNA resulted in 85 exclusively mammalian hits with ... under accession AJ437692 Further analyses were performed with the online tools of the European Bioinformatics Institute (http:// www.ebi.ac.uk/), BLAST database searches in the GenBank database of ... Consortium (2001) Initial sequencing and analysis of the human genome Nature 409, 860–921 Kawai, J., Shinagawa, A. , Shibata, K., Yoshino, M., Itoh, M., Ishii, Y., Arakawa, T., Hara, A. , Fukunishi,...
- 6
- 450
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... (especially that the proliferation index was about 5%) as well as the data from the literature, the diagnosis of well-differentiated endocrine carcinoma of the pancreas was established Both adrenals ... probably suggesting that they are not a direct result of inactivation of the MEN1 gene Page of Since the malignant potential of MEN1-related adrenal neoplasia is of important clinical significance, ... sensitivity and specificity of the CA-125 Although cardiovascular, lung and chronic liver diseases are the most frequent diagnoses in patients with increased CA-125, other intra-abdominal non-malignant...
- 7
- 412
- 0
Báo cáo y học: "Protein Never in Mitosis Gene A Interacting-1 regulates calpain activity and the degradation of cyclooxygenase-2 in endothelial cells" pot
... Effect of PIN1 knockdown on calpain and cathepsin activity Activities were determined from the initial rate of cleavage of fluorogenic substrates for calpain (A) , or cathepsin (B) These were assessed ... ester]-threonine-proline-leucine-lysine~serine-proline-proline-proline-serineproline-arginine-[5-((2-aminoethyl)amino)naphthalene1-sulfonic acid], and carboxybenzyl-phenylalaninearginine-7-amido-4-methylcoumarin were ... scanned and digital images of proteins were analyzed Calpain activity Calpain activity was measured as described by Tompa et al [26] Cells were washed with and scraped in ml of icecold PBS, and...
- 9
- 457
- 0
Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc
... TGAAACTAGTTACCAGATCATAACAACCCTCA AGAGGGTTGTTATGATCTGGTAACTAGTTTCA TTTTTTCTAGA-3' was inserted into pGE-1 to be as pGE-CTMP In addition, a scrambled interfering RNA was used as the negative control The ... were against the nucleotides 179 to 208 and 553 to 582 of the CTMP-7 gene respectively: 5'-GGATCCCGCAGGCCAAAGACAACAATAGT GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAAACTAGTTACCAGATCATAACAACCCTCA ... was the fusion yeast containing pGBK-Lam and pACT-LT b Amino acid sequence features of CTMP-7 The amino acid sequence of CTMP-7 contains the typical tetraspanin-enriched domain with four transmembrane...
- 12
- 302
- 0
Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx
... disruption of the STAT1 gene in mice revealed a role for STAT1 in the JAK-STAT signaling pathway [40] The JAK-STAT signaling pathway is involved in mediating biologic responses induced by many cytokines ... bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' – Amplicon length = 72 bp As an internal control, a set of ... replication was determined as in Fig Each point represents the mean ± SEM (n = 16) Panel B DNA was isolated and the amount of viral genomic DNA was determined by Taq-Man PCR as described in Materials...
- 13
- 266
- 0
Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps
... disruption of the STAT1 gene in mice revealed a role for STAT1 in the JAK-STAT signaling pathway [40] The JAK-STAT signaling pathway is involved in mediating biologic responses induced by many cytokines ... bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' – Amplicon length = 72 bp As an internal control, a set of ... replication was determined as in Fig Each point represents the mean ± SEM (n = 16) Panel B DNA was isolated and the amount of viral genomic DNA was determined by Taq-Man PCR as described in Materials...
- 13
- 468
- 0
Đại số 10 ban A từ tiết (1-21)
... chọn kết sai kết sau (a) ( A B ) = A A B ; (b) ( A B ) = A B A ; (c) A \ B = A A B = ; (d) A \ B = A A B ; Câu Cho số gần : a= 2,23 , (a) a < 0, 008 (b) a < 0, 009 (c) a < 0, 007 ... * ĐN (SGK) : A B = {x\ x A x B} * NX: A B = B A A A= A A =A * VD2(SGK): b) phép giao: * ĐN(SGK): A B= {x\ x A x B} * NX: A B= B A A A= A A = * VD3 (SGK): * H7 (SGK) : A B tập hợp ... kết sai kết sau (a) ( A B ) = ( A B ) ( A B )(b) ( A B ) A = A\ B (c) ( A B ) A = B \ A (d) (A\ B) \ A = Câu Cho mệnh đề ch a biến P(x) : x2- = Hãy xác định tính - sai mệnh đề sau : (a) ...
- 46
- 407
- 0
ĐỀ THI THỬ ĐẠI HỌC CAO ĐẲNG NĂM 2010 MÔN TOÁN KHỐI A ĐỀ 1
... lớn Ta có : + x 1 + y = z ⇔ x y + y z + z x = Điều gợi ý ta đ a đến hướng xyz A B C , y = tan , z = tan 2 A B B C C A Nếu A, B,C ∈ (0; π ), A + B + C = π t a n t a n + t a n t a n + t a n t a ... OBC tam giác vuông O , OB = a, OC = 3, (a > ) đường cao OA = a Gọi M trung điểm cạnh BC Tính khoảng cách hai đường thẳng AB,OM Chọn hệ trục t a độ hình vẽ Khi O(0;0;0), a a ; A( 0; 0; a 3), ... 0; a 3), B (a; 0; 0), C (0; a 3; 0), M ; 2 gọi N trung điểm AC ⇒ N 0; 0 , a a 3 ; 2 MN đường trung bình tam giác ABC ⇒ AB // MN ⇒ AB //(OMN) ⇒ d(AB;OM) = d(AB;(OMN))...
- 5
- 255
- 0
KỲ KSCL THI ĐẠI HỌC NĂM HỌC 20122013 LẦN 1 ĐỀ THI MÔN TOÁN KHỐI A, A1 SỞ GD&ĐT VĨNH PHÚC
... ỡ x + y = a ù a + a (b+ 5) = -8 t ị h(I)cúdng: ị a + a (a + 2) = - xy - x = b a - b = ù ợ ợ 0.25 a + a + a + =0 ( a + 2)( a - a + 4) = a = -2 ị b =1 ộỡ -3 + ù x= ờù ờù -1 ù y= ỡ a = -2 ỡ x ... bng bin thiờn suy ra, phng trỡnh cú hai nghim thc phõn bit thỡ 1 + Ê m < (Cútht t = 0.25 x - 3, t 0) 1,0im S K A I B H E O D C GiHltrngtõmcatamgiỏcABD, Iltrungimca AB. 0.25 a ã SH ^ ( ABCD ... ))=HK Tacú HE = 2 a 1 2a AB = ị = + = + ị HK = 2 3 HK SH HE 5a a 57 AC 3 3a Do = ị d ( A( SBC )) = d ( H ( SBC))= HC 2 57 0.25 1,0im Btngthctngngvi 2 ( tan x - cot x ) - ( cos x ) m- ( tan x...
- 7
- 1,268
- 33
Tài liệu Đề thi tuyển sinh đại học, cao đẳng năm 2010 môn Toán - Khối A (Đề 1) pdf
... lớn Ta có : + x 1 + y = z ⇔ x y + y z + z x = Điều gợi ý ta đ a đến hướng xyz A B C , y = tan , z = tan 2 A B B C C A Nếu A, B,C ∈ (0; π ), A + B + C = π t a n t a n + t a n t a n + t a n t a ... OBC tam giác vuông O , OB = a, OC = 3, (a > ) đường cao OA = a Gọi M trung điểm cạnh BC Tính khoảng cách hai đường thẳng AB,OM Chọn hệ trục t a độ hình vẽ Khi O(0;0;0), a a ; A( 0; 0; a 3), ... 0; a 3), B (a; 0; 0), C (0; a 3; 0), M ; 2 gọi N trung điểm AC ⇒ N 0; 0 , a a 3 ; 2 MN đường trung bình tam giác ABC ⇒ AB // MN ⇒ AB //(OMN) ⇒ d(AB;OM) = d(AB;(OMN))...
- 5
- 440
- 0
Tài liệu Đề và đáp án luyện thi đại học 2010 khối A-B-C-D đề 1 pptx
... Cõu VI .a: 1) C i xng vi A qua ng thng d ị C(3; 1) ỡB, D ẻ d AB = AD = ị B(2; 1), D(6; 5) ợ r r a ^ n r r r ộ 2) E ẻ (d2) ị E(3; 7; 6) rV rP ị aV = nP , ad ự = -4(1;1; -1) ị (D): ỷ aV ^ ad1 ợ ... PCD = a 27 VS.PCD SP 2 ù = = ị VS PCD = VS ACD = a ùV ợ S ACD SA Cõu V: Ta cú: x > 0, y > 0, x + y = ị < xy Ê ổx + ốy P= ỗ yử 22 + = Du "=" xy x = y = Vy, minP = ữ + xứ xy II PHN T CHN Theo ... Khong cỏch gia cỏc im cc tiu: d = m - m + = ỗ m - ữ + ị Mind = m = ố 2ứ p Cõu II: 1) PT sin3 x - 2sin 2 x + 3sin x + = sin x = -1 x = - + kp ỡ x - x y + xy - y3 = (1) ù ộx = y 2) Ta cú: (1)...
- 2
- 572
- 1
Tài liệu A resource for reading and words part 1 ppt
... is fine has his lunch at three o'clock does not call at the office works alone in the office enjoys walking in the park We can infer from the passage that - A) it was a fine autumn day B) the ... sentences with a suitable form of the words defined above After breakfast I take a around the base checking that all the daily tasks have been completed for signs of damage and only store those in ... the British not look at anybody in the train the British are in fact have a tendency to talking Englishmen always read something the writer wanted to stay for another year READING COMPREHENSION...
- 15
- 706
- 3
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... wings of the signal The broad lineshape and the enhanced relaxation properties of the signal at 77 K indicate that the YÆ is coupled to a paramagnetic centre, presumably the metallocofactor It ... view, C ammoniagenes restricts the incorporation of iron into R2F in vivo, even in the absence of manganese, and it is the availability of manganese that is the limiting factor determining the amount ... software, as described above Analysis of metals Manganese and iron have been determined by GF-AAS and ICP-MS [As a result of problems with the protein matrix in the analysis of metalloproteins,...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Modulation of cyclin D1 and early growth response factor-1 gene expression in interleukin-1b-treated rat smooth muscle cells by n-6 and n-3 polyunsaturated fatty acids pdf
... concentration of the caveolin-3 isoform, mainly found in muscle, was also measured [30] Western blot analysis showed that EPA and DHA increased the amount of intracellular caveolin-3, whereas AA had no ... whether the incorporation of PUFA also affected the concentration of the p42/44 MAPK in caveolae Pretreatment with EPA or DHA increased the amount of ERK1/2 protein, whereas the incorporation of ... results indicate that AA-induced cyclin D1 promoter activity is mediated mainly via the Ras/Raf pathway, and that incorporation of n-3 PUFAs interferes with these signalling molecules The cyclin D1...
- 12
- 499
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25