match each half sentence in column a with a suitable one in column b mỗi câu 0 25 điểm
Báo cáo khoa học: "Improving Grammaticality in Statistical Sentence Generation: Introducing a Dependency Spanning Tree Algorithm with an Argument Satisfaction Model" pptx
... Philadelphia, July Hal Daum´ III and Daniel Marcu 200 4 A < /b> phrasee based hmm approach to document/abstract alignment In < /b> Proceedings of EMNLP 200 4, Barcelona, Spain Dan Shen and Mirella Lapata 200 7 ... was also obtained from the PTB training data, referred to as PTB-LM Additionally, a < /b> 4-gram language model was obtained from a < /b> subsection of the BLLIP’99 Corpus (LDC number: LDC 200 0T43) containing ... generation, Morristown, NJ, USA Colin Bannard and Chris Callison-Burch 200 5 Paraphrasing with < /b> bilingual parallel corpora In < /b> Proceedings of the 43rd Annual Meeting of the Asso- 859 Irene Langkilde...
- 9
- 305
- 0
THE SIMPLE SENTENCE IN TRADITIONAL GRAMMAR AND THE CLAUSE SIMPLEX IN SYSTEMIC FUNCTIONAL GRAMMAR a COMPARATIVE STUDY
... 3-4 (b) : Relational processes in < /b> Vietnamese Behavioural clauses Behavioural clauses construe (human) behaviour, including mental and verbal behaviour, as an active version of verbal and mental ... in < /b> general and on language teaching in < /b> particular in < /b> several parts of the world, including Vietnam For a < /b> long time, sentence < /b> has been the main content of grammar teaching at schools As a < /b> result, ... passive transformation + Adverbial: An adverbial (i) is an adverb, adverb phrase, adverbial clause, noun phrase, or prepositional phrase (ii) is generally mobile, i.e is capable of occurring in < /b> more...
- 59
- 1,140
- 13
báo cáo hóa học:" Comparison of transverse wires and half pins in Taylor Spatial Frame: A biomechanical study" pdf
... ( 0. 12) 2.11 ( 0. 05) 0. 49 ( 0. 04) 2.94 ( 0. 07) 2.63 ( 0. 08) 0. 60 ( 0. 04) 75° 2.36 ( 0. 07) 2 .09 ( 0. 09) 0. 46 ( 0. 06) 2.67 ( 0. 10) 2.17 ( 0. 11) 0. 51 ( 0. 03) 60 2 .09 ( 0. 08) 1.91 ( 0. 11) 0. 35 ( 0. 02) ... 0. 35 ( 0. 02) 2.63 ( 0. 04) 2.11 ( 0. 04) 0. 51 ( 0. 07) 45° 2 .04 ( 0. 10) 1.84 ( 0. 08) 0. 34 ( 0. 05) 2.11 ( 0. 05) 2 .09 ( 0. 07) 0. 45 ( 0. 06) All values in < /b> Nm/deg and brackets show SD The half < /b> pins show ... load displacement curve by linear regression between 2 50 and 300 N loading Windhagen et al used a < /b> similar methodology but a < /b> different range ( 300 to 3 50 N) [9] 2 50 to 300 N load was used for analysis...
- 7
- 426
- 0
báo cáo hóa học:" Research Article Extremal Values of Half-Eigenvalues for p-Laplacian with Weights in L1 Balls" potx
... a,< /b> b : Θ a,< /b> b : max {Θ 0 , a,< /b> b − 0 } max{Θ 0 , a,< /b> b − 0 }, 0 ∈R 2.8 {Θ 0 , a,< /b> b − 0 } min{Θ 0 , a,< /b> b − 0 }, 2.9 0 ∈ 0, 2πp 0 ∈ 0, 2πp 0 ∈R λL m λL a,< /b> b : λ > | Θ a,< /b> b m R λm a,< /b> b ... Lemma 2.1 i , one < /b> has Θ 0 , 0 a0< /b> , 0 b0 − 0 Θ ϑ, 0 a0< /b> , 0 b0 − ϑ ≤ mπp , Thus Θ 0 a0< /b> , 0 b0 mπp , ∀ϑ ∈ 0, 2πp 4. 10 mπp It follows from 2. 10 and 2.13 that r : | a0< /b> , b0 |γ > and 0 ≥ ... a0< /b> , b0 is the minimizer of ν : Hm r and X is the corresponding half-< /b> eigenfunction Let w0 a0< /b> b0 By Theorem 4.5, a0< /b> , b0 ∈ γ S r and a0< /b> and b0 not overlap, thus w0 γ | a0< /b> , b0 |γ r 4 .25 Combining...
- 21
- 326
- 0
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' ... 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' ... siRNAs Sense Antisense siRNA1 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'...
- 8
- 576
- 0
Báo cáo y học: "Successful outcome of a pregnancy in a woman with advanced cirrhosis due to hepatitis B surface antigenemia, delta super-infection and hepatitis C co-infection: a case report" pdf
... following delivery showed small esophageal varices and mild portal gastropathy The baby was given active and passive immunization against hepatitis B At the age of 18 months the baby's blood was ... varices, abdominal collateral veins, hypersplenism and ascites Endoscopic variceal band ligation or sclerotherapy, portosystemic shunting, esophageal transection and beta-blockers are the therapeutic ... uncomplicated vaginal delivery without any massive bleeding She did not have further hepatic decompensation, sepsis or any other complication The baby boy had normal Apgar scores and birth weight and had...
- 3
- 289
- 0
Báo cáo y học: " Successful long-term monotherapy with rituximab in a patient with chronic lymphocytic leukemia of the B-cell-lineage: a case report" pdf
... April 200 6 Since WBCs started to rise again months after the last administration, rituximab maintenance therapy was reassumed in < /b> November 200 6 at a < /b> dosage of 375 mg/m2 every months The general condition ... clear [3] Although fludarabine as monotherapy or in < /b> combination with < /b> cyclophosphamide appears to be a < /b> highly effective regimen in < /b> CLL, many patients are still treated with < /b> chlorambucil as a < /b> first ... therapy was accompanied by severe marrow toxicity, with < /b> virtual disappearance of normal leucocyte precursors and megakaryocytes on a < /b> bone marrow aspirate, as well as by a < /b> lack of efficacy Although...
- 5
- 257
- 0
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... Schabes 1997 Tree-Adjoining Grammars In < /b> G Rozenberg and A < /b> Salomaa, editors, Handbook of Formal Languages, chapter 2, pages 69– 123 Springer-Verlag, Berlin H Kautz and B Selman 1998 Blackbox: A < /b> ... presupposes that Y is in < /b> Z In < /b> a < /b> scenario that involves multiple rabbits, multiple hats, and multiple individuals that are inside other individuals, but only one < /b> pair of a < /b> rabbit r inside a < /b> hat h, the ... If a < /b> node carries a < /b> null adjunction constraint (indicated by no-adjoin), no adjunction is allowed at this node; if it carries an obligatory adjunction constraint (indicated by adjoin!), an auxil337...
- 8
- 339
- 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... Biologicals, USA) followed by a < /b> 30- min incubation with < /b> cyanine3-labeled goat anti-rabbit IgG (dilution : 400 , Jackson Dianova) NaCl/Pi was used for washing sections between different incubation steps ... peformed with < /b> polyclonal rabbit anti-(SR-BI) IgG (dilution of : 100 0) followed by goat anti-rabbit cyanine3 secondary antibody (dilution : 500 ) pathway The fact that the C-terminal cytosolic domain ... choriocarcinoma cells were incubated as described above Total RNA was isolated, and Northern blot analysis was performed using radiolabeled SR-BI cDNA probe for each < /b> cell line (top panel) in < /b> the absence...
- 12
- 470
- 0
Tài liệu Báo cáo khoa học: "Sentence Disambiguation by a Shift-Reduce Parsing Technique" pot
... shift-reduce table at each < /b> stage The combination of the stack, input, and state of the parser will be called a < /b> configuration and will be notated as, for example, Right Association Native speakers of ... have demonstrated that a < /b> parser using simple general rules for disambiguating sentences can yield appropriate behavior for a < /b> large class of performance phenomena right a-< /b> ~soeiation, minimal attachment, ... summarize, preterminal delaying, as an intrinsic part of the algorithm, does not actually change the basic properties of the algorithm in < /b> any observable way Note, however, that preterminal assignments,...
- 6
- 396
- 0
Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf
... varia (alfalfa), Arabidopsis thaliana, Oryza sativa (rice), Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, and mammals Combining the ASBD and pro®les with < /b> a < /b> variable linker between ... 200 ± 303 (Fig 2) A < /b> second domain extending from amino acids 325 383 was capable of independently binding to GST -A < /b> (Fig 2) These regions were named A < /b> subunit binding domains (ASBD) and Given that ... h at ambient temperature (or h at 30 °C, where indicated), the reaction was diluted to 500 lL with < /b> buffer B [buffer A < /b> containing 0. 1% nonidet p 40 (NP- 40) and 0. 25% BSA] and 20 lL of a < /b> prewashed...
- 7
- 550
- 0
Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot
... stand-alone A-< /b> domain that activates b- lysine by adenylation It was also found that S noursei harbours a < /b> protein that after activation speci®cally binds b- lysine as a < /b> thioester This protein contains ... [27]), BacB_M1 (a-< /b> lysine, module of bacitracin synthetase B, accession no AAC06347), BacB_M2 (a-< /b> ornithine, module of bacitracin synthetase B, Acc.No AAC06347), GrsB_M3 (a-< /b> ornithine, module of gramicidin ... activate aromatic carboxylic acids or an amino acid such as alanine as adenylates, which in < /b> turn are loaded to speci®c PCP domains These PCPdomains are either alone-standing PCPs, as in < /b> the biosynthesis...
- 11
- 559
- 0
Báo cáo khoa học: X-ray structure of glucose/galactose receptor from Salmonella typhimurium in complex with the physiological ligand, (2R)-glyceryl-b-D-galactopyranoside pdf
... to Salmonella GBP Protein GBP Ribose-binding protein Allose-binding protein Segment Val 108 10. 3 Gly 109 39.7 Thr1 10 18.4 Asp111 )25. 7 Set112 )18.9 Glu114 ) 10. 9 Ile 101 )14.4 Ala 102 )24.2 Val254 ... Fig Interactions in < /b> the binding site (A)< /b> Stereoview of bound GGal showing GBP residues making hydrogen-bonding and aromatic interactions (B) Schematic diagram of the hydrogen bonds between GBP and ... & Jones TA ( 200 1) Molray – a < /b> web interface between O and the POV-Ray ray tracer Acta Crystallogr D 57, 1 201 –1 203 Kleywegt GJ (1997) Validation of protein models from C-alpha coordinates alone...
- 9
- 360
- 0
Báo cáo khoa học: "Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification" pdf
... and accurate automatic polarity-classification Indeed, last but definitely not least! We are currently running experiments that 3 50 300 3 50 a < /b> b c 300 Counts 2 50 2 50 200 200 1 50 1 50 100 100 50 ... 113-1 40 Amsterdam: Benjamins Kieras, David E 1978 Good and Bad Structure in < /b> Simple Paragraphs: Effects on Apparent Theme, Reading Time, and Recall Journal of Verbal Learning and Verbal Behavior ... it has been somewhat supported by the computational results of Yang, Lin and Chen (Yang et al., 200 7a,< /b> Yang et al., 200 7b) who classified emotions of posts in < /b> blog corpora Yang, Lin & Chen realized...
- 5
- 356
- 0
Báo cáo khoa học: "Evaluating a Trainable Sentence Planner for a Spoken Dialogue System" doc
... remaining approaches differ In < /b> the first approach, SP OT, we learn constraints from training material; in < /b> the second approach, rule-based, we construct constraints by hand 3.3 SPoT: A < /b> Trainable Sentence < /b> ... same 1 200 Number of plans with < /b> that score or more 100 0 800 600 AMELIA SPOT IC RB NOAGG RAN 400 200 1.5 2.5 Score 3.5 4.5 Figure 8: Chart comparing distribution of human ratings for SP OT, RBS, ... top-ranked output to input to the surface realizer The SPR is automatically trained by applying RankBoost (Freund et al., 1998) to learn ranking rules from training data The training data was assembled...
- 8
- 236
- 0
Production of transgenic deepwater indica rice plants expressing a synthetic Bacillus thuringiensis cryIA(b) gene with enhanced resistance to yellow stem borer docx
... patterns in < /b> Western blot analysis [ 10, 13,14,16] About 0. 01 0. 1% of Bt protein was estimated in < /b> both transformants, determined by comparing the intensity of the band with < /b> known 60 kDa pure 10 ng cryIA (b) ... described by Lin et al [ 30] 2.5 Insect bioassay Plants (T0 and T1) positive in < /b> Southern or Western blot analysis were tested for resistance against the YSB A < /b> single stem cutting (about cm long) with < /b> ... T0 plants (VA 10 and VA6) and one < /b> T1 progeny (VA6-4) of VA6 All three plants show bands expressed from cryIA (b) Bt gene Besides the expected 65 kDa, two additional bands between 46 and 30 kDa...
- 6
- 345
- 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
... pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by RT-PCR ... folded in < /b> buffer containing 10 mm Tris ⁄ HCl (pH 7 .0) , 10 mm MgCl2 and 100 mm KCl at 37 °C for prior to partial cleavage by 0. 05 UÆlL)1 RNase T1 (Fermentas, China), 0. 001 lgÆlL)1 RNase A < /b> and 0. 001 ... was created by WebLogo [47] The HP1 and HP2 regions are indicated, with < /b> stems being marked by cyan bars and the RNase-accessible joint and loop regions by red bars (D) RNase footprinting analysis...
- 14
- 379
- 0
Báo cáo khoa học: Bacterial b-peptidyl aminopeptidases with unique substrate specificities for b-oligopeptides and mixed b,a-oligopeptides pptx
... 0. 026 ND 0. 009 0. 98 1.9 0. 68 0. 47 0. 047 0. 095 0. 068 0. 007 ND 0. 008 0. 017 0. 006 ND 0. 028 0. 84 3.1 ND 0. 063 ND 0. 047 0. 45 0. 38 0. 46 0. 21 0. 0 40 0. 40 0 .05 0 0. 008 ND 0. 011 0. 015 0. 011 < 0. 001 0. 016 ... 3-2W4 BapA and Y2 BapA The kinetic parameters of 3-2W4 BapA and Y2 BapA were determined for H-bhVal-bhAla-bhLeu-OH, H-bhAla-bhLeu-OH, carnosine and H-bhGly-pNA (Table 3) 3-2W4 BapA cleaved the b- peptides ... ª 200 6 The Authors Journal compilation ª 200 6 FEBS B Geueke et al Bacterial b- peptidyl aminopeptidases 3 400 400 A < /b> B C D Peptides (mM) 200 Are a < /b> Are a < /b> 200 - 200 10 14 Ret time (min) - 200 10 18...
- 12
- 269
- 0
Báo cáo khoa học: "Regression for Sentence-Level MT Evaluation with Pseudo References" pdf
... 0. 316 0. 473* 0. 419 0. 418 0. 429 0. 349 0. 354 0. 418 0. 3 30 0.333 0. 413 0. 314 0. 315 0. 386 0. 298 0. 306 0. 401 0. 3 30 0.318 MT-7 0. 301 0. 459* 0. 397 0. 4 10 0.421 0. 404 0. 333 0. 403 0. 394 0. 327 0. 388 0. 3 10 0.284 ... 0. 284 0. 365 0. 316 0. 302 0. 414 0. 3 80 0.392 MT- 10 -0. 045 0. 247 0. 321* 0. 312 0. 243 0. 2 40 0.243 0. 201 0. 268 0. 267 0. 219 0. 282 0. 274 0. 158 0. 223 0. 228 0. 122 0. 242 0. 283 Table 3: Correlation comparisons ... machine learning approaches to MT evaluation, both with < /b> human references (Corston-Oliver et al., 200 1; Kulesza and Shieber, 200 4; Albrecht and Hwa, 200 7; Liu and Gildea, 200 7) and without (Gamon...
- 8
- 290
- 0
- cấu trúc di truyền của 1 quần thể người về hệ nhóm máu a b ab o 0 25 ia ia 0 20 ia io 0 09 ib ib 0 12 ib io 0 30 ia ib 0 04io io 1
- teacher asks the students to match each item in a with one in b by guessing the story group of four
- match each half sentence in column a with a suitable one in column b
- read the text carefully and fill in each blank with a suitable word mỗi câu 0 25điểm
- objective by the end of the lesson students will be able to specific information about the english classes and decide a suitable one for themselves
- listen and match each name in column a with one activity in coloumn b
- the aims and objective by the end of the lesson students will be able to specific information about the english classes and decide a suitable one for themselves
- join each of the sentences in column a with a related sentence in column b 2 5 pts
- match the sentences in column a with a related sentence in column b then use a suitable relative pronoun to join the two sentences ex2 p81 82
- look at the pictures then match the half sentences in column a to those in column b write the full sentences in your exercise book
- discuss and match each of the descriptions to a type of music
- match the first part of each sentence in a with the appropriate part in b make a meaningful sentence
- make all the changes and additions to produce from the following sets of words and phrases sentences which together make a complete letter 2 5 p 10 x 0 25 2 5 p
- match each word in column a with the meaning in column b
- match each half sentence in column a with a suitable one in column b moói caõu 0 25 ủieồm
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25