match each word in column a with the meaning in column b

hoa duoc

Ngày tải lên : 15/05/2015, 01:00

... mass using an analytical balance is the most basic measurement made in an analytical laboratory Determining and comparing mass is fundamental to assays such as moisture and fat determination Accurately ... only by the readability of the balance Repeatedly weighing a standard weight can yield valuable information about the calibration of the balance and the technicians technique Once the performance ... general acceptance of procedures, they are validated by collaborative studies involving several laboratories Collaborative evaluations are sanctioned by groups such as AOAC International, AACC International,...

171
2.1K
0

INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx

Ngày tải lên : 07/03/2014, 16:20

... Water bath, capable of operating at 41,5 °C ± °C, or incubator, capable of operating at 41,5 °C ± °C 6.5 Water baths, capable of operating at 44 °C to 47 °C 6.6 Water bath, capable of operating at ... media Rappaport-Vassiliadis medium with soya (RVS broth) and Muller-Kauffmann tetrathionate/novobiocin broth (MKTTn broth) are inoculated with the culture obtained in 4.2 The RVS broth is incubated ... by using only anti-sera prepared by a supplier recognized as competent (for example, by an appropriate government agency) Apparatus and glassware Disposable apparatus is an acceptable alternative...

34
690
0

Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

Ngày tải lên : 17/03/2014, 00:20

... consisting of just a least element ⊥ with n maximal elements incomparable to each other For a given λ we can represent this in b bits by choosing the smallest b such that b λ+1 ≥ n and assigning each ... maximal elements to satisfy cardinality constraints; adding one new bit to each nonmaximal meet irreducible type; and propagating all the bits down the hierarchy to satisfy the subset constraints ... resemble trees Both their technique and ours are at a disadvantage when applied to large trees; in particular, if the bottom of the partial order has successors which are not joinable with each other,...

10
410
0

Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot

Ngày tải lên : 23/03/2014, 20:20

... exhibits far fewer matches, and their extent is less It is clear that a program can rank Candidate higher than Candidate simply by comparing ngram matches between each candidate translation and the ... of these possible choices, but not all Indeed, recalling all choices leads to a bad translation Here is an example Example 4: Candidate 1: I always invariably perpetually Candidate 2: I always ... paired t-statistics which are displayed in Table The t-statistic compares each system with its left neighbor in the table For example, t = for the pair S1 and S2 Note that the numbers in Table...

8
336
0

Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)

Ngày tải lên : 26/03/2014, 21:55

... scale that can be read to at least the nearest 0.1 % of the full scale load (Note 2) The dial shall be readable within % of the indicated load at any given load level within the loading range In ... with a watertight sealant Use microcrystalline wax or a mixture of three parts paraffin to ﬁve parts rosin by mass Paraffin wax is permitted as a sealant with molds that clamp to the base plate ... mold that will be contacting the base plate Clamp the mold to the base plate and wipe any excess sealant from the interior of the mold and base plate NOTE 5—Because aerosol lubricants evaporate,...

10
851
0

Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

Ngày tải lên : 30/03/2014, 21:20

... coefﬁcient (Bhattacharyya, 1943) between p(fk |w1 ) and p(fk |w2 ) This is the baseline for BCb BCa The Bhattacharyya coefﬁcient with absolute discounting In calculating p(fk |wi ), we subtract the ... where the answers for each word are the other words in the set the word appears in We output a ranked list of 500 similar words for each word using a given similarity measure and checked whether they ... tricks) In experiments, we estimate semantic similarities using a large amount of Web data in Japanese and show that the proposed measure gives better word similarities than a non-Bayesian Bhattacharyya...

10
472
0

a novel method for the synthesis of titania nanotubes using

Ngày tải lên : 05/05/2014, 15:26

... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... PC, Shimadzu) Fine BaSO4 powder was used as a standard for baseline and the spectra are recorded in a range 200–800 nm Further characterization of the TiO2 nanotubes was carried out by high-resolution ... It can be seen that the titania nanotubes annealed under N2 atmosphere give better absorption in a visible region (band gap, 2.8–2.9 eV) compared with the samples annealed under O2 (band gap,...

8
634
0

a novel method for the synthesis of cao nanoparticle

Ngày tải lên : 06/05/2014, 08:55

... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... investigated from line by Debye-Scherrer formula was estimated broadening of the peak at 2θ=0 10° via using to be 15 nm The information obtained from XRD also confirms the above findings Debye-Scherrer ... with reactive site on the CaO via using a solvent The GC chromatograms surface including Bronsted acid and Lewis acid and area under curve (AUC) data’s are shown sites In particular the blocking...

12
705
0

solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

Ngày tải lên : 06/05/2014, 13:26

... (ecb) in the valence band (VB) can be excited to the conduction band (CB) with the simultaneous generation of a hole (hvb+) in the VB Excited-state ecb and hvb+ can recombine and become trapped ... area and a greater interspace between the nanosheets than the other samples A greater interspace between the nanosheets can effectively prevent aggregation during the photodegradation, and a larger ... the range 23 ȝm In addition, each flower was made up of many thin nanosheets as “petals”, and these nanosheets were about 30 nm in thickness Further information about the ZnO product was obtained...

26
551
0

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

Ngày tải lên : 20/06/2014, 04:20

... RGR participated in the planning of the experiments, data analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors ... different treatments, performed the microscopic analysis and helped with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue ... The Mutability and Repair of DNA In Molecular Biology of the Gene Edited by: Benjamin Cummings Cold Spring Harbour Laboratory Press; 2004:235-258 10 Belka C, Marini P, Lepple-Wienhues A, Budach...

4
403
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

Ngày tải lên : 20/06/2014, 04:20

... respectively There was no delay between final cast removal and fitting of D -B splint The mean duration of the treatment up to application of the D -B Splint was 9.6 weeks Initial correction was obtained in ... performs the casting technique in all the patients DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript ... lateral aspect of the skin overlying the talar head This healed with local dressing only The mean time to heal the sore was days (range 6-8 days) The corrective manipulation and cast was not applied...

7
531
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

Ngày tải lên : 20/06/2014, 07:20

... respectively There was no delay between final cast removal and fitting of D -B splint The mean duration of the treatment up to application of the D -B Splint was 9.6 weeks Initial correction was obtained in ... performs the casting technique in all the patients DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript ... lateral aspect of the skin overlying the talar head This healed with local dressing only The mean time to heal the sore was days (range 6-8 days) The corrective manipulation and cast was not applied...

7
802
0

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Ngày tải lên : 21/06/2014, 01:20

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison between QDs and superparamagnetic nanoparticle-based hybridization and type-specific ... the study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis All authors read and approved the final manuscript Competing interests The authors...

9
469
0

Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx

Ngày tải lên : 21/06/2014, 01:20

... Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin (Rmutr), Bangkok 10100, Thailand 3Centre of Excellence in Mathematics, Che, Si Ayuthaya Road, Bangkok 10400, Thailand ... C be a nonexpansive mapping, and let B : C ® H be a ξ-inverse strongly monotone If < an ≤ 2ξ, then S - anBS is a nonexpansive mapping in H Page of 20 Onjai-uea et al Fixed Point Theory and Applications ... the set of solutions of variational inequality problem in a real Hilbert space Jaiboon [11] suggests and analyzes an iterative scheme based on the hybrid steepest descent method for finding a...

20
350
0

Báo cáo hóa học: " Research Article The Shrinking Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Mappings" ppt

Ngày tải lên : 21/06/2014, 05:20

... S.-Y Matsushita, K Nakajo, and W Takahashi, “Strong convergence theorems obtained by a generalized projections hybrid method for families of mappings in Banach spaces,” Nonlinear Analysis Theory, ... variationalinequality problems for two monotone mappings in Banach spaces,” Optimization Letters In press 26 A Tada and W Takahashi, “Weak and strong convergence theorems for a nonexpansive mapping ... of the variational inequality with the bifunction Fj , j problem There is a considerable investigation on CFP in the setting of Hilbert spaces which captures applications in various disciplines...

25
495
0

Báo cáo hóa học: " Research Article Hybrid Method for a Class of Stochastic Bi-Criteria Optimization Problems" docx

Ngày tải lên : 21/06/2014, 07:20

... that the stochastic constraint is satisﬁed with a probability as higher as possible.For the Journal of Inequalities and Applications general stochastic constraints A w x ≥ b w , we obtain their ... probability the constraints are satisﬁed In other words, the chance constraints approach can guarantee that the obtained solution has less degree of constraint violation see 4, 11 Based on such a reformulation ... for the second objective, and transform the original problem into a problem with single-objective function For the stochastic parameters, we introduce an appropriate combination of the mean and...

12
387
0

Báo cáo hóa học: " Research Article A General Projection Method for a System of Relaxed Cocoercive Variational Inequalities in Hilbert Spaces" pot

Ngày tải lên : 22/06/2014, 18:20

... quadratic programming, and variational problems In this paper, we consider, based on the projection method, the approximation solvability of a system of nonlinear relaxed cocoercive variational ... cocoercive variational inequalities in Hilbert spaces,” Applied Mathematics Letters, vol 20, no 3, pp 329– 334, 2007 [4] F Giannessi and A Maugeri, Eds., Variational Inequalities and Network Equilibrium ... Mathematics, Shijiazhuang University, Shijiazhuang 050035, China Email address: meijuanshang@yahoo.com.cn Yongfu Su: Department of Mathematics, Tianjin Polytechinc University, Tianjin 300160, China...

9
256
0

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

Ngày tải lên : 23/06/2014, 00:20

... equation under consideration into an equivalent linear or nonlinear operator equation in an abstract separable Hilbert H or Banach H1 space Then, after some manipulations, we bring the linear ... Equation (3.4) is a nonlinear ordinary difference equation, that is, a difference equation of p = variable As a consequence, we will work in the Banach space 1 and the isomorphic abstract Banach ... details, see [11] and the references therein) Also, by assuring the existence of a solution of a difference equation in the space or , we obtain information regarding the asymptotic behavior of the...

12
257
0

A MODIFIED QUASI-BOUNDARY VALUE METHOD FOR A CLASS OF ABSTRACT PARABOLIC ILL-POSED PROBLEMS M. pot

Ngày tải lên : 23/06/2014, 00:20

... method is called quasi-boundary value method, and the related approximate problem is called quasi-boundary value problem (QBVP) We show that the approximate problems are well posed and that their ... evolution equations, Journal of Mathematical Analysis and Applications 47 (1974), no 3, 563–572 , Cauchy problem for hyperparabolic partial diﬀerential equations, Trends in the Theory [13] and Practice ... 4, 7] Finally, we obtain several other results, including some explicit convergence rates The case where the operator A has discrete spectrum has been treated in [5] The approximate problem Deﬁnition...

8
256
0

Radio Occultation Method for Remote Sensing of the Atmosphere and Ionosphere docx

Ngày tải lên : 29/06/2014, 16:20

... (appeared as linear or parabolic trend) in the phase path excess without noticeable variations in the amplitude of RO signal Analysis of CHAMP data indicates importance of the amplitude variations ... obtained by other technical means RO sounding of the atmosphere allows obtaining information not only about the above mentioned characteristics of the atmosphere, but also about the wave, layered and ... are the constants in the interval of integration t If changes in the amplitude A j ( j ) of partial rays are small then integration in equation (3.2.8) may be fulfilled analytically with accounting...

176
302
0