... string of such co-ordinates A polygon is a closed line The grid-based format of data is captured as information of each quadratic cell ina screen and could be looked at asa photo of the area GIS ... because this is not yet a standard toolin the available GIS- packages The visualisation of the disease rates on digital maps can be misleading because the eye tends to interpret point patterns as ... the case farm and all farms at risk within a specified area of the outbreak Buffer zones can be drawn around those farms as shown in Fig and with a link to tables of the addresses of the farms at...
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... close to (Clas % and Clas % 0) as can be inferred from the primary data However, it is interesting that a slight reduction in las activity resulted ina very strong decrease in growth rate and glycolytic ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products...
... island and cell columns, is formed which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase ... (primer Aand C, not shown) was abundantly present in JAr and Jeg3 cells while only negligible amounts became apparent in BeWo cells In parallel (using primers Aand C) a faint 540 bp band (indicative ... IgG and ECL development [30] Reverse-transcriptase-polymerase chain reaction Total RNA from choriocarcinoma cell lines was isolated by using RNeasy kit (Qiagen, Vienna, Austria) Three micrograms...
... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... different measures are shown in Table 7. Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... pond area in the province. As shown in Fig. 2, the total area of brackish water shrimp culture has increased approximately 4 times, from 251 ha in 2000 to 902.5 ha in 2007. According ...
... hematopoietic compartment using a CD34+ hESC-derived starting population has been considered asa potential AIDS therapy, andasa way to alleviate secondary effects produced by anti-retroviral ... cell anemia carrying the human mutant variant of the b-globin gene (bS) that is responsible for the disease Fibroblasts froma diseased animal were reprogrammed into iPSCs, and the sickle cell anemia ... Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative medicine...
... contextual and cultural coherence, several inventories designed to measure spirituality ask for specific and locally valid religious beliefs and practices (i.e church attendance and praying) and/ or assume ... statistical analysis and drafted the manuscript TO participated to conceive and design the study assisted in statistical analysis and helped to draft the manuscript PFM participated in the design and ... value in measuring SpR attitudes and engagement of patients coping with life-threatening illness, andin the measurement of distinct aspects of QoL An advantage of our instruments is the clear-cut...
... in plant breeding), values of and upward are suitable for quality control analysis, and values of above are excellent, and can be used in any analytical situation RESULTS The RMS values obtained ... structures in lignins by cleavage of arylglycerol-β-aryl ether bonds Asa single method, thioacidolyse has a definite advantage in that it may be used to characterize unambiguously typical and prominent ... (SEP) We thus obtained a calibration file containing 67 samples anda validation file containing 20 samples LK lignin contents and S/G ratio values for the validation samples were in line with the...
... growing and water availability was likely high after winter rains Total precipitation during March, April and May 1998 at site H was about 130 mm and air temperatures were between 15 and 25 °C In ... performed in September 1998, with the aim of estimating the maximum annual impact of water stress in areas at different levels of landscape degradation a Istanbul Ankara Bursa Izmir Antalya Adana c ... recorded in O oleaster at sites H and D1 i.e between 89 and 92% In contrast, O oleaster plants growing in sites D2 and D3 had RWC’s as low as 70 to 72% A progressive decrease in RWC was recorded in...
... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical ... published in the British Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea...
... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... and animals [5] and is involved in multiple signal transduction pathways, which are fundamental for many intercellular and intracellular interactions [6,7] Calcium plays an essential role in pollen-pistil ... Trewavas AJ: Imaging and measurement of cytosolic free calcium in plant and fungal cells J Microsc 1992, 166:57-86 26 Webb AAR, McAinsh MR, Taylor JE, Hetherington AM: Calcium ions as intracellular...
... interpretation, and drafted the manuscript LE was the lead for statistical analysis RT was involved in study design and data interpretation SR was involved in study design and data interpretation All authors ... measurements Bland Altman plots for sputum percentage and numbers/ ml at baseline and year are shown in Figure For percentages, the mean change was a 3.5% increase at year compared to baseline, with ... Screening and Year Mean of Screening and Year 60 40 20 -20 -40 -60 20 40 60 80 100 120 Mean of Screening and Year Figure Bland Altman plots of the mean measurements at baseline and year (x-axis) and...
... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... combination of session and condition Each condition was measured in different sessions In simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and ... Comparison of normalisation, standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from...
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... further investigation, since there are ambiguous results and evidence for and against on that matter Acknowledgements The authors thank practical trainees Linda van Mierlo and Pascalle Weijzen from...
... an infrastructure-creating network (The TEL LAPLAND Network) Case I – The Lohja Area Environmental Cluster The Lohja area is an old industrial area in western Uusimaa province in southern Finland ... organization development which utilizes learning networks asa means for disseminating and generating knowledge of new practices, and examines opportunities for this approach in Finland by looking ... opposed values and principles – at least, not ina Nordic workplace environment The pace of change in companies’ operating environment has accelerated, and the development needs and challenges that...
... signal transduction cascade that recruits an ADP-ribosylation factor guanine nucleotide exchange factor (such as ARNO) to the apical plasma membrane ARNO facilitates ADP-ribosylation factor activation ... disease Because HXA3 may play an important step underlying the pathophysiology of in ammatory diseases, such asin ammatory bowel disease, the investigation of human 12-LOX genes at mucosal surfaces, ... Protein kinase Calpha-dependent increase in Ca2+-independent phospholipase A2 in membranes and arachidonic acid liberation in zymosan-stimulated macrophage-like P388D1 cells Biochem Pharmacol 63,...
... measurements The VH domains in camelid heavy chain antibodies are most similar to the classical VH3 family andas such bind protein A with micromolar affinity Furthermore, the protein A binding ... that can be rapidly explored using a phage selection Design of a heavy chain antibody scaffold A conceptually similar approach was employed by Bond et al in the design of a camelid heavy chain ... that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained froma statistical analysis of selected phage populations [16] We also discuss experiments addressing...
... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... Data analysis All spectra were treated with in- house software working ina MATLAB environment (MATLAB 6, Mathworks Inc., Natick, USA) Spectra were separated ina training set constituted of 48 samples ... including several areas in lipid andin nucleic acid regions, and one area associated with proteins (amide II) Training set spectra were used for model building in LDA The model was tested with...
... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases anda C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... shots and masses were externally calibrated with All -in- 1 Protein Standards (Ciphergen Biosystems Inc.) All data were normalized for total ion current and peak areas calculated using the indirect ... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia...