information if true have a direct impact on the health of my patients and is it something they will care about
Global Inequalities at Work: Work’s Impact on the Health of Individuals, Families, and Societies pdf
... Bangkok, Chief of the International Occupational Safety and Health Information Centre (CIS), Chief of the Safety and Health Information Services Branch, and Chief of the Occupational Safety and ... that the conditions Leti, Humberto, and Laura faced at work were having a dramatic impact on the health and welfare of their families A Focus on the Individual in the Field of Occupational Health ... examination of published research on occupational health and a review of what is being taught In a review of 30 occupational and environmental health programs from the United States, Canada, Australia,...
- 354
- 472
- 0
Báo cáo lâm nghiệp: "an Phytophthora quercina have a negative impact on mature pedunculate oaks under field conditions" pptx
... data on water relations and mineral nutrition is available for infected oaks under field conditions The knowledge about the effects of Phytophthoras on mature oaks under natural conditions is therefore ... length and concentration of P in the soil and leaves was evaluated using the Pearson correlation All statistical calculations, except the Pearson correlation, were performed using SuperAnova 1.11 and ... stands, a split-plot design was used Each of the five infested stands was thus paired with a non-infested stand with similar stand characteristics The pairing of stands was primarily based on...
- 12
- 233
- 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx
... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...
- 5
- 435
- 0
Báo cáo y học: "Clinical importance and impact on the households of oseltamivir-resistant seasonal A/H1N1 influenza virus in healthy children in Italy" ppt
... (Bari); Paolo Siani (Napoli); Ilaria Sala and Maria Cristina Diana (Genova) for their contribution to study enrolment, and Shahjahan Miah for his technical assistance 14 Author details Department of ... Giovani Ricercatori 2007) We would like to thank Laura Cesati, Laura Gualtieri and Emanuela Laicini (Milan, Italy); Andrea Papaleo and Luigi Cantarutti (Padua, Italy); Domenico De Mattia (Bari); ... (0.05 μM); A/ H3-forward CCTTTTTG TTGAACGCA-GCAA (1 μM); A/ H3-reverse CGGATGAGGCAACTAGTGACCTA (1 μM); A/ H3-probe VICCCTACAGC-AACTGTTACCMG BNFQ (0.25 μM); B-forward TCACGAAAAATACGGT GGATTAAA (0.75...
- 4
- 307
- 0
Báo cáo y học: "Armed conflicts have an impact on the spread of tuberculosis: the case of the Somali Regional State of Ethiopia" pptx
... collection, data analysis and drafted the manuscript GB: Was involved in data collection, data analysis and in writing the manuscript All authors read and approved the final version of the manuscript ... Sumaya Ali and the staff of the Regional Health Bureau of the Somalia Regional State of Ethiopia for the support they provided during the field work phase of this research The field work part of ... exist in the SRS: these are; pastoralism, agro-pastoralism and urban [12] An estimated 85% of regional populations earn their livelihoods from pastoralism or agro-pastoralism The Regional TB control...
- 6
- 312
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... needs: adequate membrane hydration and avoidance of water flooding in the cathode catalyst layer and/ or gas diffusion layer [2] Water management is related with air supply to the cathode and is one ... high loading conditions The results also showed that the ambient conditions (ambient temperature and relative humidity) have a strong impact on the temperature distribution and hygro-thermal stresses ... [12] The geometric and the base case operating conditions are listed in Table Values of the electrochemical transport parameters for the base case operating conditions are listed in Table The material...
- 16
- 727
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... knowledge and of innovations implies the application of intelligence, tacit knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does ... external knowledge and its application to problem solving; the creation of new knowledge and the generation of innovations from this integration, and finally the importance of the organization’s capacity ... that characterizes the process of technological innovation and the creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge and Process Management CASE...
- 10
- 1,063
- 1
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... business, a natural outgrowth of the financial and operating information it compiled and sold The company merged with Standard Statistics, another information and ratings company, in 1941, to form Standard ... His data appear to indicate that as early as 1850 the U.S corporate bond market was as large or larger than that of countries such as Great Britain and France, and that by the eve of World War ... financial leadership, the Americans went on within a century to succeed the English as the world’s pre-eminent national economy Larry Neal, The Rise of Financial Capitalism: International Capital Markets...
- 30
- 611
- 1
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf
... greater scale and scope And the world is a less certain place New concerns about the implications of operational and personnel tempo and the distribution of responsibilities through the ranks of the ... additional training are linear Rather, the authors note that although the magnitude of the trade-off may vary, it is at least one-to-one and in some cases even larger This finding and the ones above ... training/development, and recruitment and retention programs of the armed forces Accurate data on the relationship between performance on the one hand and ability, experience, and training on the...
- 87
- 627
- 0
A Modern Treatise on the Principle of Legality in Criminal Law doc
... that the only legitimate standard for accepting a mistake of law defense is the standard of a strict liability mistake.90 This standard significantly reduces the probability that a mistake of law ... criminal norm is that it contains no explicit criminal sanction) 2.1.1 Valid Conditional Clauses Logically there are two types of conditional clauses4: valid and invalid A valid conditional clause ... representation, social reflection, and social consensus, in offences of mala in se and mala prohibita, and in the formal publication of the criminal norm In order to understand the distinction of mala...
- 214
- 2,149
- 0
Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf
... In particular,one of the English realizationsmay be the English preposition since, which is thus one candidate for an acceptable translation Because the prepositional phrase is a modifier of the ... we have the prepositional phrase Seit der Wiederaufbauphase Seit as a German preposition in one of its readings is linked into U M o as a concept that specializes a more general relation ... relations and entities, called the upper model The upper model is typically used to mediate between the organisation of knowledge found in an application domain and the kind of organisation that...
- 9
- 680
- 1
Addressing the Impact of Household Energy and Indoor Air Pollution on the Health of the Poor: Implications for Policy Action and Intervention Measures pot
... practices and habits In addition to the appliance costs and operating costs, durability, appearance, ease of operation and maintenance, convenience and flexibility are among those factors that ... less direct health impacts associated with a range of other energy-related socioeconomic factors The total evidence available on the health consequences is of variable extent and quality, partly ... indoor air pollution and health, nevertheless they may also cause a variety of altered states and behaviours, which may not be directly related to the impact of indoor air pollution on health With...
- 52
- 578
- 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT ... NRG -a_ rev NRG-5¢_for NRG-Beta_rev GAPDH_for GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG ... at a ¨ concentration of lm GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma, Deisenhofen, Germany) was used at a concentration...
- 13
- 487
- 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... both the public and private sectors Unfortunately, beyond data on nationality and year of arrival as derived from immigration and registration data, no further information was available on the ... because when they reach the age of 16, they have their own garda card and they have to apply for their own visa" (Agatha, Philippines, 50 s) A related issue for the children of migrant nurses was ... expectations of Ireland beyond a continued right to work and earn a salary Their version of migration – to stay, earn and leave – was perhaps also a closer "fit" with the Irish model of migration...
- 12
- 495
- 0
Báo cáo hóa học: " Research Article A New Estimate on the Rate of Convergence of ´ Durrmeyer-Bezier Operators" ppt
... 1, and x ∈ 0, is ξ1 is a random variable with two-point distribution P ξ1 i Journal of Inequalities and Applications n a parameter) Set ηn k ξk , with the mathematical expectation E ηn σn > Then ... sz-Mirakyan operators on functions a of bounded variation,” Journal of Mathematical Analysis and Applications, vol 233, no 2, pp 476–483, 1999 A N Shiryayev, Probability, vol 95 of Graduate Texts ... 2000 R Bojani´ and F H Chˆ ng, “Rate of convergence of Bernstein polynomials for functions with c e derivatives of bounded variation,” Journal of Mathematical Analysis and Applications, vol 141,...
- 7
- 272
- 0
Báo cáo lâm nghiệp: "Effects of a clear-cut on the in situ nitrogen mineralisation and the nitrogen cycle in a 67-year-old Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) plantation" potx
... Nitrogen availability All parameters of nitrogen availability, i.e nitrogen contents in the soil and mineralisation (or nitrification) rate decreased significantly after the harvest, demonstrating ... canopy uptake, net nitrification, net ammonification and net mineralisation of N (015 cm) before and after harvest (all data in kg Nãha1ãyr1) Bulk precipitation Dry deposition Total deposition ... residual nitrates in soil solutions, rate of nitrification in laboratory incubations, and structure of microbial populations Once again Douglas-fir soil had one of the highest nitrifying capacities...
- 12
- 432
- 0
Báo cáo khoa học: "Impact of different leaf velocities and dose rates on the number of monitor units and the dose-volume-histograms using intensity modulated radiotherapy with sliding-window technique" potx
... the same "optimal fluence map" and thereby the impact on the number of monitor units and the dose-volume-histogram of the organs at risk (OAR) We found larger impacts on the results for patients ... Influence of different maximum leaf velocities on the number of monitor units applied Mean of the number of monitor units of all fields against the leaf velocity of both patient with prostate cancer and ... outside the end position of the leafs In these cases the choice of the LV and the DR is more important than for PC, because the influence on the NMU and transmission radiation is very high Another alternative...
- 9
- 288
- 0
báo cáo khoa học: "Still too little qualitative research to shed light on results from reviews of effectiveness trials: A case study of a Cochrane review on the use of lay health workers" potx
... treatment The qualitative data was published in the same report as the randomised trial, and authors discussed the apparently contradictory results, including a discussion of the qualitative data ... data collection methods and/ or data analysis In at least four of these six cases, the qualitative data were not the only focus of the paper In these 14 trials, lay health worker programmes had ... qualitative data 10 trials: qualitative data collection referred to but not available Figure Flow chart trials: qualitative data collection carried out pre-trial 14 trials: qualitative data collection...
- 5
- 411
- 0
Báo cáo khoa học: "A longitudinal study on the occurrence of Cryptosporidium and Giardia in dogs during their first year of life" docx
... the statistical analyses, drafting and revising of the manuscript BKG and LJR have been involved in drafting and critical revision of the manuscript All authors have approved the manuscript Acknowledgements ... Kirkpatrick (1988) [31] found that an urban locality gave a higher risk of parasitic infection compared with a non-urban locality Since G duodenalis of Assemblage A occurs in a wide range of mammalian ... litters would have had on the results within a season, and one cannot say with any degree of certainty that the differences were truly related to season Several other studies have found seasonal...
- 10
- 507
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25