ict platform based distributed control in electricity grids with a large share of distributed energy resources and renewable energy sources
Báo cáo khoa học: "Towards a feasible algorithm for tight glycaemic control in critically ill patients: a systematic review of the literature" pdf
... Methods of insulin administration Insulin was administered in different ways: subcutaneously, continuous intravenous infusion combined with intravenous bolus injections, or insulin combined with ... D, McKinstry C, Padkin A: Implementing intensive insulin therapy: development and audit of the Bath insulin protocol Anaesth Intensive Care 2004, 32:311-316 Dazzi D, Taddei F, Gavarini A, Uggeri ... 'sliding' or 'dynamic' scales With a sliding scale a predetermined amount of insulin is administered, according to the range in which the actual blood glucose value is For example, every patient with...
- 7
- 326
- 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... decompose into in ation expectations and in ation risk premia Due to a lack of data, we cannot this, and instead we estimate in ation forward rates as part of our model Vol No Estimating In ation ... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... forecast data gives unrealistic estimates of in ation expectations and in ation risk premia, however: ten-year-ahead in ation expectations are implausibly volatile and can be as high as percent and...
- 32
- 347
- 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Of ce: rbainfo@rba.gov.au Abstract We estimate in ation ... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... high in ation in Australia Interestingly, there appears to have been a sustained general rise in inflation expectations between 2004 and 2008 at all horizons Again this was a time of rising domestic...
- 39
- 395
- 0
Machine learning based congestion control in wireless sensor networks
... The available bandwidth at a sensor node continually changes in reason of interferences, multi-path fading and burst packets AIMD based methods performs continually rate adjustment to adapt to a ... problematic It has to determine the rate that verifies simultaneously the constraints of several forwarding nodes, and in the same time has to maintain fair sharing of bandwidth Multiple paths routing ... observed at proximity of the sink where nodes forward a large amount of traffic The average traffic rate is the inverse of the average inter arrival time The packet arrivals intervals it are averaged...
- 108
- 1,225
- 0
the implementation and adopting of activity based costing in manufacturing vietnamese companies a case study of samsung vina corporation
... application, assembling and training teams that have responsibility of ABC in company, and developing and sustaining the ABC database The first factor is the developing of policies and standards involve ... really effective and efficient, this part also supports to enhance the above analyze 36 3.4 Data analyze Analysis of data is a process of inspecting, cleaning, transforming, and modeling data with ... than the opportunities, as well as analyze and explain the changes in the area of methodology and organization of a company, after activity -based costing implementation The research findings are...
- 64
- 1,356
- 3
báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx
... postural control associated with the performance of a secondary cognitive task The ability to stand as still as possible was evaluated under single task (standing still) and dual task (standing still ... example, that mechanical effects from articulation and respiration during dual task performance influence the amplitude of COP variability even in the absence of a changing attentional demand ... current findings, expand our understanding of what constitutes meaningful clinical change in ApEn values, and determine the sensitivity and specificity of ApEn for detecting differences among diagnostic...
- 7
- 603
- 0
Báo cáo hóa học: " Structure-dependent growth control in nanowire synthesis via on-film formation of nanowires" pptx
... nanowires at the edge is higher in the factor of 1.3 than that at the center, and the total density increased as the Bi film area increased after annealing at 270°C for 10 h (see Figure 3e) This indirectly ... S, Duvail JL, Radulescu A, Ferain E, Legras R: Fabrication and properties of organic and metal nanocylinders in nanoporous membrane J Mater Res 1999, 14:3042 Liu K, Chien CL, Searson PC, Zhang ... during thermal annealing is expected to be favored for nanowire growth through enlarged grain boundaries These results indicate that surface morphology and grain structure of the Bi film, along...
- 6
- 174
- 0
Báo cáo y học: "Effectiveness of electronic guideline-based implementation systems in ambulatory care settings - a systematic review" pot
... Computerized asthma guidelines + paper version of the guidelines for asthma and angina Intervention group two: Computerized angina guidelines + paper version of the guidelines for asthma and angina N ... DR, BA, and PD gave methodological advice and commented on subsequent drafts of the paper All authors read and approved the final manuscript Additional material Additional file Search strategy ... 2008) indexed in the Medline database, Embase, the Cochrane Central Register of Controlled Trials and CRD (DARE, HTA and NHS EED databases) was conducted The search strategy was sensitive The search...
- 12
- 361
- 0
Báo cáo y học: "Attributable mortality of Acinetobacter baumannii infections in critically ill patients: a systematic review of matched cohort and case-control studies" doc
... colonization and infection with A baumannii increase morbidity and mortality independently of other factors 11 The attributable mortality, in hospital and in the ICU, of patients with A baumannii infection ... patients (48 infected and 27 colonized) with Ab [16] Critical Care Acquisition of Ab in critically ill patients in ICU; medical and surgical ICU in Spain [20] Falagas et al [21] Available online ... or infection with A baumannii is not associated with increased mortality, but instead that the severity of the illness of cases and controls is the major determinant of mortality Finally, Sofianou...
- 8
- 323
- 1
Báo cáo y học: "implementation and evaluation of the SPRINT protocol for tight glycaemic control in critically ill patients: a clinical practice change" ppsx
... Chase and colleagues [21,23,38] and Hann and colleagues [38] used a model that captured the rate of insulin utilisation, insulin losses, and saturation dynamics and that has been validated using ... assisted in data collection and the analysis and interpretation of the data DL provided statistical assistance CH provided mathematical assistance during the development of SPRINT All authors read and ... Natali A, Gastaldelli A, Camastra S, Sironi AM, Toschi E, Masoni A, Ferrannini E, Mari A: Dose-response characteristics of insulin action on glucose metabolism: a non-steady-state approach Am...
- 15
- 250
- 0
Báo cáo y học: "Malaria control in Timor-Leste during a period of political instability: what lessons can be learned" docx
... use of RDT and ACT in malaria control in Timor-Leste ACT has been shown to be effective in treating drug-resistant falciparum and vivax malaria in Papua, Indonesia [27] It has been used in emergency ... lack of clean water supplies, poor sanitation and waste management, overcrowding and poor shelter can increase the risk of communicable diseases including malaria [2,6,7] The increase of malaria ... statistical analysis and presentation Thanks also to Kayli Wayte who provided useful comments on an earlier draft Malaria Unit staff: the late Dr Fernando Bonaparte, Dr Milena Lay, Maria Mota and Johaness...
- 10
- 292
- 0
Báo cáo y học: "A comprehensive platform for quality control of botanical drugs (PhytomicsQC): a case study of Huangqin Tang (HQT) and PHY906" potx
... biological sensitivity and standardized methodology Huangqin Tang (HQT) is a classical Chinese medicine formula for treating gastrointestinal ailments including diarrhea, nausea and abdominal cramps ... introduced at the electrospray interface allowing mass measurements to be within 0.0002 amu With external standards, mass accuracy to 0.002 amu was routine with experimental and theoretical mass matching ... chemical and biological characterization While the traditional chemical analysis of standard marker compounds provides a useful quantitative mass balance, patterns of information-rich chemical fingerprints...
- 15
- 303
- 0
Residue correction based data assimilation in coastal hydrodynamics (with an application to singapore regional model
... include two main large water bodies, the South China Sea and the Andaman Sea, together with a small part of Java Sea Large scope of the seas around the Singapore was included in the model and the ... sub-areas of the region: e.g., the South China Sea area (Shaw and Chao, 1994; Zu et al., 2008), the Singapore Strait area (Chen et al., 2005; Chan et al., 2006) and the Malacca Strait up to the Andaman ... desirable forecasting at long forecast horizons with only a handful of sample points Such scheme can be applied to improve the forecasting accuracy of water level around Singapore area and also...
- 196
- 258
- 0
ICT adoption and social change in rural south asia a case study of grameen telecom in bangladesh
... countries have infringed with the traditional communication patterns embedded in the social and cultural fabric of the traditional societies (Roche, et.al, 1996) Building and maintaining a national infrastructure ... one of the leading broadband users in the world Taiwan, Japan and Singapore have their own positions as well in the world map of ICT adoption But Asia 12 also includes countries like Afghanistan, ... Study Region Dhaka zonal office has eight area offices under its jurisdiction: Gajipur, Dhamrai, Singair, Kapasia, Saturia, Manikganj, Sripur and Shibalaya This research selected 10 villages for its...
- 135
- 682
- 0
A comparative analysis of institutions, national policies, and cooperative responses to floods in Asia
... debris in mountain areas, while in deltas and wetland areas they can prevent and alter natural drainage, thus increasing the duration and height of floods During post-disaster periods there is often ... explaining success and failures in their performance and in behavior of main stakeholders Analysis of major lessons learned about coping capacities/incapacities of the countries during catastrophic ... countries of Asia 3.3.2 Asia: a variety of national institutional designs A variety of institutional frameworks to counteract floods are in place in the countries of Asia, including legislation and...
- 39
- 534
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in...
- 11
- 445
- 0
Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc
... (eds.): ISICT 2003, Proceedings of the International Symposium on Information and Communication Technologies, pages 311–316 Trinity College Dublin, Ireland JAMA 2004 JAMA: A Java Matrix Package Publicdomain, ... for large sparse text data using clustering Machine Learning, 42(1/2):143–175 Jan Hajiˇ 2000 Morphological tagging: Data vs dicc tionaries In Proceedings of the 6th ANLP Conference, 1st NAACL ... Implementation and time complexity For solving multiple linear regression we use a public-domain Java package JAMA (2004), developed by the MathWorks and NIST The computation of inverse matrix is based...
- 6
- 447
- 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
... C32 6A AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA ... TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACAGTTTAGCTCGGTACC CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT ... CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT named according to the amino-acid residues substituted by alanine and their respective position in the...
- 7
- 404
- 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf
... implementation In Trinidad and Tobago, the strategy recently expired The Bahamas, St Lucia, and St Vincent and the Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica St Kitts ... coordinator In Guyana and St Lucia the HIV/AIDS coordinator is financed by the MoH Information on Bahamas and Barbados is not available Details on the sources of funding for financing the coordinator were ... All countries also reported that these regimens include maintenance of school buildings and facilities in all schools Anguilla Antigua The Bahamas Barbados Belize Dominica Grenada Guyana Jamaica...
- 40
- 450
- 0
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx
... of cautionary, and kind demanding than isolation exercises, breaking of commonsense Few of you will want to down more muscle tissue and requiring more the same exercises over and over again in ... easiest fix is to use a variety of hand fifth week Rather than taking the entire week positions-neutral (palms facing each other) off from training, you scale back the weights and overhand (palms ... easy for anyone reading this, but the total-body program is in another league If training programs were animals, HFT for Arms would be a pit bull- a tough sumbitch by any standard- while Total-Body...
- 112
- 530
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008