i have argued that the responsibilities of a citizen to promote the public interest might clash with one apos s responsibilities to his or her own moral value system
LETTERS OF A BUSINESSMAN TO HIS SON
... Owning integrity is owning a way of life that is strong in moral principles-characteristics such as sincerity, honesty, and straightforwardness in your daily living patterns In the business world, ... manner—interrupting someone while he is speaking—is a conversational habit that diminishes a lot of people s images in my eyes This is a tactless and frustrating insult to the person speaking Many a person s conversation ... ability to manage a business of his own, and yet who is absolutely worthless to anyone else, because he carries with him constantly the insane suspicion that his employer is oppressing, or intending...
- 49
- 464
- 1
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... initial phenotypic characterization of the strain 10457 with a commercial identification system, API-20 E identified the strain as Hafnia alvei [4] Additional phenotypic characterization and partial ... residues (324 amu) This implies that not only the furanosidic linkage is acid-labile, but also that of the b-D-GalNAc residue Thus, assuming that the linkage second most easily hydrolyzed is that of ... approximately 5% In the methylation analysis of the O-polysaccharide, derivatives corresponding to 6-substituted galactofuranose, 3-substituted galactopyranose and 3-substituted galactosa- Ó FEBS...
- 7
- 463
- 0
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT ... AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT ... AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC d GGGAAAATAGAGTGTGAATCAGCAGAGACCACC...
- 10
- 308
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
... rows to export to the array startRow The row number of the first row to export fields A string array containing the names of the columns to export If this parameter is null, all columns are exported ... GetRows( ) method of the ADO Recordset or method that converts the Recordset into a two-dimensional array This solution presents an ADO.NET method, which is also called GetRows( ), that duplicates ... Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected from the table dt The DataTable to convert to the array rowCount The number of...
- 5
- 309
- 0
Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx
... in the organization and maintenance of the slit diaphragm As the three putative docking sites are similar, one possibility is that such complexes could contain oligomers of same ligand that adjust ... such as diabetes [34] This implies that there has to be signalling from the slit diaphragm into the podocytes, and vice versa Nephrin is very probaly a major player in this signalling Transfection ... that the C-terminal half may be more accessible to kinases, or simply that the C-ter234 minal half contains more phosphorylation sites than the N-terminal half The last possibility is the most...
- 16
- 333
- 0
The duties of a citizen pot
... sake of the community The first view, held by individualists, emphasizes the privileges of a citizenship One says, the State exists for the good of the citizen – and that is true; the other says, ... privileges) and that he has an obligation to it (his duties) However, as we are in no danger of forgetting our privileges as citizens, it is wise to emphasize our duties The first obvious duty of a citizen ... with the second and third meanings only What, then, are the duties of a citizen to his city and his country? A citizen is the member of a community, whether that community is a town or a great...
- 7
- 214
- 0
Báo cáo y học: "The treatment of condylar fractures: to open or not to open? A critical review of this controversy" pdf
... Ewers R A 3-dimensional finite-element analysis investigating the biomechanical behavior of the mandible and plate osteosynthesis in cases of fractures of the condylar process Oral Surg Oral Med ... fracture classification, as well as data collection and reporting, need to be established so that valid comparisons among studies can be made Studies with adequate sample sizes to determine clinically ... movements and the masticatory system; degree and direction of dislocation of the condyles; difficulty of surgical access; risk of lesion in critical anatomic structures; risk of hypertrophic and/or...
- 6
- 433
- 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt
... differentiate factor 5; OR = odds ratio showed a negative association of these two polymorphisms with nonsyndromic CDH [29] Whether these two polymorphisms are associated with hip dysplasia or ... physical examination The severity of CDH was defined from mild instability of the femoral head with slight capsular laxity, to moderate lateral displacement of the femoral head, without loss of ... observed This indicates that the SNP may be associated with severity of CDH, but a definite conclusion could not be made because the sample number was so limited and no significant association was detected...
- 5
- 443
- 0
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
... relevant features such as myasthenia gravis were recorded as well as surgical complications Statistical Analysis For all statistical analysis SPSS 14.0 software (SPSS Inc., Chicago, IL, USA) was used ... survival analysis WHO classification was not independent in the Cox-regression analysis For clinical use and estimation of the patients' prognosis WHO classification is not as useful as the Masaoka ... the univariate analysis, it failed in the multivariate analysis due to its correlation with clinical Masaoka stage Masaoka stage has a stronger relevance than WHO classification to determinate...
- 10
- 355
- 0
báo cáo khoa học: " Complementation of a phycocyanin-bilin lyase from Synechocystis sp. PCC 6803 with a nucleomorph-encoded open reading frame from the cryptophyte Guillardia theta" pot
... Kobayashi T, Momoyama Y, Higashiyama T, Minoda A, Sano M, Nomoto H, Oishi K, Hayashi H, Ohta F, Nishizaka S, Haga S, Miura S, Morishita T, Kabeya Y, Terasawa K, Suzuki Y, Ishii Y, Asakawa S, Takano ... trypsin autolysis peaks as internal standards (842.5100, 2211.1046 Da) Monoisotopic masses were assigned and processed using Biotools ™ and FlexAnalysis ™ software (Bruker Daltonics) before submitting ... validated by tandem MS-MS analysis of selected peptides In silico Analysis Blast search analyses were done by NCBI protein-protein blast [45] (see Additional file 1) This program was also used...
- 12
- 221
- 0
Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt
... Recognition of iatrogenic causes of an acidosis: the use of albumin solutions for resuscitation is common in paediatrics, and may become more widespread in adult practice since the publication of ... regression with the use of the ordinary least-squares method (Microsoft Excel) Results Acid–base and biochemical results are shown in Table A significant metabolic acidosis was seen for the group ... taken on an atypical patient could potentially bias the regression analysis To investigate this we reanalysed the data in two ways First, a standardised residual plot was inspected, which did not...
- 7
- 325
- 0
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1
... carbon atoms Step sites are the preferred adsorption sites for carbon atoms and can act as nucleation sites for the formation of graphene islands On-surface carbon atoms are relatively unstable ... when all the sites in the first subsurface layer are occupied by carbon atoms VI Calculations indicate that boron atoms preferentially bind at the step sites and at octahedral sites just below the ... frequencies for ammonia synthesis as a function of the adsorption energy of nitrogen for various transition metals and alloys 16 Figure 2.5 The calculaterd potential energy diagram for NH3 synthesis...
- 18
- 257
- 0
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 2
... Ni-based catalysts during the catalytic partial oxidation of methane The coking resistance of Ni-based catalysts with different catalyst loadings but with a similar Ni to B atomic ratio of about ... investigations are combined with experimental validation and optimization to design improved Ni catalysts This thesis is organized as follows In chapter 2, an overview is given of the state-ofthe-art ... sites that initiate catalyst deactivation Based on this molecular level understanding, boron is proposed as promoter to enhance the stability of Ni catalysts In this thesis, first principles DFT investigations...
- 159
- 575
- 0
Topic 9: The rights and duties of a citizen
... 3 infringe (v): xâm phạm, vi phạm redress (n): s a sai, uốn nắn, s đền bù, b i thường totalitarian (adj): chuyên chế subordinated to (v): làm cho phụ thuộc vào slanderous (adj): vu khống, ... slanderous (adj): vu khống, phỉ báng misconduct (n): hành vi sai tr i thoughtlessness (n): vô ý thức, nông cạn, h i hợt 10 conscious (adj): biết được, nhận ra, có ý thức ...
- 2
- 233
- 0
Development of a method to measure consumer emotions associated with foods
... Confusion Vigor Anxiety Depression Hostility Sensation seeking and positive affect 1.4 Facial scaling Another approach to measuring emotions has been the use of facial scaling A number of different ... two positive scales, sensation seeking (more active) and positive affect (more passive), and three negative scales, anxiety, depression, and hostility The authors point out the similarities between ... procedures The goals of these series of studies were as follows: Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches...
- 10
- 781
- 3
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
... plasma chamber was analysed by using the 2D Poisson software To start the simulations, the initial parameters of the solenoid coils with iron jacket were fixed as: inner radius 75 mm, outer radius 150 ... configurations This was accomplished by varying the size of the solenoid coils, thickness of iron jacket, and amp-turns (NI) The optimum values of NI for the side and middle solenoid coils were obtained ... using standard relations for calculating magnetic field Design, fabrication, and characterization of a solenoid system 463 Table The optimized design parameters for solenoid coil with iron jacket...
- 8
- 650
- 0
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf
... Materials and methods Bacterial strains, plasmids, restriction enzymes and chemicals The bacterium Ochrobactrum sp M231 was isolated from the soil at a pesticide factory in Tianjin, China, and stored ... residual enzymatic activity after incubation for 10 at various temperatures Enzymatic activity was then assayed using the standard enzyme assay Data points correspond to the mean values of three independent ... time step of the simulation was set at fs, and the coordinates were saved for analysis every ps Post-processing and analysis were performed using standard Gromacs tools and customized Perl scripts...
- 8
- 740
- 0
Tài liệu Regulatory Rights Supreme Court Activism, the Public Interest, and the Making of Constitutional Law doc
... making his position more practical He distinguishes between historical understandings of the practices that constitutional rights prohibited, on the one hand, and historical understandings of the ... value of text and history Yet, in my view, sophisticated accounts of the place of the historical document in constitutional analysis largely drain textualism and originalism of consequence as serious ... cases on the basis of pragmatic judgment This is perfectly clear in decisions implicating individual rights that the written Constitution is said to vouchsafe The Bill of Rights identifies various...
- 274
- 920
- 1
báo cáo hóa học: " Development of a proxy-reported pulmonary outcome scale for preterm infants with bronchopulmonary dysplasia" ppt
... behaviors and actions in each domain This file shows a table of the domains and behaviors/actions used in the second survey, with an indication of whether the behavior/action was classified as ... in the five phases illustrated in Figure Phase 1: Identification of domains, items, and responses We identified an appropriate set of activity domains and assessments for inclusion in the scale ... respiratory rate” as a respiratory rate above 60 or, if the infant s baseline respiratory Page of 11 rate was already above 60, an “increase” is defined as a respiratory rate above the baseline We...
- 11
- 490
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25