Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor Evelyn M. Teh 1 , Jeff Hewitt 1 , Karen C. Ung 1 , Tanya A. M. Griffiths 1 , Vinh Nguyen 1 , Sara K. Briggs 2 , Anne B. Mason 2 and Ross T. A. MacGillivray 1 1 Department of Biochemistry and Molecular Biology and Centre for Blood Research, University of British Columbia, Vancouver, Canada 2 Department of Biochemistry, University of Vermont, College of Medicine, Burlington, Vermont, USA The transferrins (TF) are a group of metal-binding pro- teins that are involved in iron homeostasis [1]. Struc- tural studies have revealed that the TFs consist of a single polypeptide chain of M r  80000 that folds into two halves called the N- and C-lobes, each of approxi- mately 330 amino acids. In human transferrin (hTF), the lobes are connected by a short peptide of seven resi- dues. Each lobe itself can be further subdivided into two domains separated by a deep cleft that forms the iron-binding site [2–4]. The N1 domain (residues 1–93 and 247–315), C1 domain (residues 340–424 and 583– 679), N2 domain (residues 94–246) and C2 domain (res- idues 425–582) are composed of a similar a ⁄ b fold in which a number of helices are packed against a central mixed b-sheet [5]. These domains are connected by two extended b-strands running antiparallel to each other forming a ‘hinge’ that allows the domains to open and close upon metal binding and release [6]. Iron is bound in a distorted octahedral coordination involving four amino acid ligands and two oxygen atoms from a synergistically bound carbonate ion. The iron–TF complex enters the cell by binding with high affinity (K d  1–10 nm) to a specific TF receptor (TFR), a type-II membrane protein consisting of two identical M r 95000 subunits covalently linked by two disulfide bonds [7]. The N-terminal region of the recep- tor projects into the cytoplasm of the cell and is joined via the transmembrane region to a 671-residue extra- cellular domain that binds TF. A soluble form of the receptor can be released by trypsin [8] or produced by recombinant techniques [9,10]. Although these forms lack the two disulfide linkages, strong noncovalent Keywords transferrin C-lobe; transferrin–transferrin receptor interaction; epitope mapping; monoclonal antibody Correspondence R.T.A. MacGillivray, Department of Biochemistry and Molecular Biology and Centre for Blood Research, University of British Columbia, Vancouver, BC, V6T 1Z3, Canada Tel: +1 604 822 3027 Fax: +1 604 822 4364 E-mail: macg@interchange.ubc.ca (Received 9 July 2005, revised 7 October 2005, accepted 19 October 2005) doi:10.1111/j.1742-4658.2005.05028.x The molecular basis of the transferrin (TF)–transferrin receptor (TFR) interaction is not known. The C-lobe of TF is required to facilitate binding to the TFR and both the N- and C-lobes are necessary for maximal bind- ing. Several mAb have been raised against human transferrin (hTF). One of these, designated F11, is specific to the C-lobe of hTF and does not recognize mouse or pig TF. Furthermore, mAb F11 inhibits the binding of TF to TFR on HeLa cells. To map the epitope for mAb F11, constructs spanning various regions of hTF were expressed as glutathione S-trans- ferase (GST) fusion proteins in Escherichia coli. The recombinant fusion proteins were analysed in an iterative fashion by immunoblotting using mAb F11 as the probe. This process resulted in the localization of the F11 epitope to the C1 domain (residues 365–401) of hTF. Subsequent computer modelling suggested that the epitope is probably restricted to a surface patch of hTF consisting of residues 365–385. Mutagenesis of the F11 epitope of hTF to the sequence of either mouse or pig TF confirmed the identity of the epitope as immunoreactivity was diminished or lost. In agreement with other studies, these epitope mapping studies support a role for residues in the C1 domain of hTF in receptor binding. Abbreviations TF, transferrin; TFR, transferrin receptor; GST, glutathione S-transferase; hTF(R), human transferrin (receptor). 6344 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS interactions still result in dimer formation. The crystal structure for the recombinant form of the soluble TFR has been determined [9], and a higher resolution struc- ture of the soluble TFR in a complex with the hemo- chromatosis gene product HFE has also been described [11]. These structures reveal that the TFR ectodomain consists of three subdomains: a helical domain respon- sible for dimerization, a protease-like domain and an apical domain. Studies with chimeric receptors made from regions of both the human and chicken TFR sug- gest that TF binds to the helical domain of the TFR [12] with at least part of the hTF binding site localized specifically to residues 646–648 in the TFR [13,14]. These studies are based on the long-standing observa- tion that hTF does not bind to chicken TFR and, recip- rocally, ovotransferrin (oTF) does not bind to the hTFR. The observation that the HFE protein and hTF bind to the same or closely overlapping sites [14] adds further support for the role of the helical domain of the TFR in binding to TF since most of the residues that bind to HFE reside in this domain. Identification of the specific regions of TF that inter- act with the TFR has remained more elusive and con- troversial. Although there is some disagreement in the literature regarding the exact region(s) of TF involved in TFR binding, it is generally accepted that both lobes of TF are required for maximal binding [15–17]. A par- ticularly intriguing aspect of the interaction of TF with the TFR is its pH dependence. At pH 7.4, diferric TF preferentially binds to TFR. At pH 5.6 (a value within the putative pH range of endosomes), iron free or apo- TF preferentially binds to TFR. Since a substantial and well-documented conformational change (60° opening and twisting [18]), accompanies the release of iron from TF, a compensating change in the TFR conformation might also be expected. In fact, the TFR has been shown to play a role in iron release from TF in a pH sensitive manner [19–21]. A structure of the hTF–hTFR complex was recently determined with cryo-electron microscopy [22]. In this model, the transferrin N-lobe is situated between the membrane and the TFR ectodo- main while the C-lobe binds to the TFR helical domain through side chain contacts of the C1 domain. More detailed information about the molecular interactions between the C-lobe and the TFR was obtained by hydroxyl radical-mediated protein footprinting and mass spectrometry [23]. In these experiments, specific C-lobe sequences (residues 381–401, 415–433 and 457–470) were protected against oxidation and thus proposed to be involved in receptor binding. Another approach to determine the regions of TF that are critical to receptor binding is the production of specific monoclonal antibodies (mAb) that can be tested for their ability to block such binding. Mason and Woodworth characterized seven high affinity anti- bodies that recognized at least four different epitopes in hTF [24]. Three of the mAbs recognized unique epi- topes in the N-lobe and two (designated E8 and F11) recognized the same or a closely overlapping epitope in the C-lobe. Interestingly, the C-lobe mAbs bound with high affinity to hTF but did not recognize six other mammalian TFs. Further studies clearly demon- strated that the C-lobe mAbs recognized both the reduced and nonreduced forms of hTF indicating that the epitope is mainly sequential rather than conforma- tional [24]. It was also noted, however, that the inter- action was sensitive to the presence or absence of iron with a two-fold higher affinity for iron loaded TF compared to apo-TF. This observation suggested that the epitope may also have a conformational compo- nent as binding of iron by either lobe of TF is accom- panied by a significant conformational change. The current study describes the localization of the mAb F11 epitope to the C-lobe of hTF, specifically to residues 365–401 that are located in the C1 domain. In particular, these results implicate this region in the binding of hTF to TFR. Results TFR binding studies The results of a study designed to determine the ability of selected mAbs to block binding of a subsaturating amount of radioiodinated hTF to TFR on HeLa cells are presented in Fig. 1. The three mAbs specific to the N-lobe demonstrated variable degrees of blocking. Fig. 1. mAb mediated inhibition of hTF binding to TFR on HeLa cells. 125 I-labelled hTF was incubated with HeLa cells in the pres- ence of increasing amounts of mAb and the resultant binding expressed as the percentage of the binding in the absence of mAb. The mAbs used were: aHT + N 1, aHT + N 2, HTF.14, F11 and E8 [24]. E. M. Teh et al. Transferrin–transferrin receptor interaction FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 6345 Two of the antibodies (aHT + N 1 and aHT + N 2 ) partially blocked binding whereas the third antibody (HTF.14) blocked virtually all binding to TFR. The antibodies to the C-lobe (F11 and E8, which share the same or a very similar epitope [24]) inhibited virtually all binding of hTF to TFR. Also, treatment of hTF with biotin resulted in a preparation of biotinylated hTF that was not recognized by the mAb F11 (data not shown). As biotin binds to lysyl residues, this result suggests that a lysyl residue may be involved in antibody–epitope recognition. Analysis of IPTG-induced fusion protein expression To identify the epitope for mAb F11, several fusion plasmids comprised of GST and various regions of TF were constructed (Fig. 2, see Experimental procedures). These constructs were expressed in Escherichia coli and the immunoreactivity of the recombinant fusion pro- teins to mAb F11 in the uninduced and IPTG-induced states was analysed by Western blot. An anti-GST serum was used to verify the production of the GST fusion proteins. Figure 3A and Fig. 4A are immuno- blots of the bacterial lysates of various GST–hTF fusions visualized with the anti-GST serum. The pres- ence of a 29-kDa band in the uninduced lanes of pGEX 4T3 (Fig. 3A, lane 1; Fig. 4A, lane 4) is probably due to low levels of constitutive expression from the pGEX promoter. Nevertheless, induction leads to a substantial increase in expression (Fig. 3A, lane 2; Fig. 4A, lane 5). Based on the intensity of the bands from equal amounts of cell lysate, both the N- and C-lobe GST fusion pro- teins were expressed at similar levels (Fig. 3A, lanes 4 and 6). As expected, full-length hTF is not recognized by the anti-GST serum (Fig. 4A, lane 1). The other constructs (hTF-5 to hTF-8 and hTF-5A to hTF-5F) were also successfully expressed and migrated at a mass Fig. 2. GST–TF fusion proteins used for western blot analysis. The fusion proteins consisted of GST (white bar) joined to regions of the hTF N-lobe (grey bar) and C-lobe (black bar). The encompassing residues of hTF in each of the GST fusion proteins are labelled above the bars. A B Fig. 3. Western blot analysis of GST–hTF fusion proteins. (A) West- ern blot analysis using an anti-GST serum before (–) and after (+) induction of the fusion protein. The following expression plasmids were used: (lanes 1–2) pGEX4T3; (lanes 3–4) hTF N-lobe; (lanes 5–6) hTF C-lobe; (lanes 7–8) hTF-5; (lanes 9–10) hTF-6; (lanes 11–12) hTF-7; (lanes 13–14) hTF-8. (B) Western blot analysis using the mAb F11 after induction of the fusion protein. The following expression plasmids were used: (lane 1) pGEX4T3; (lane 2) hTF; (lane 3) hTF N-lobe; (lane 4) hTF C-lobe; (lane 5) hTF-5; (lane 6) hTF-6; (lane 7) hTF-7; (Lane 8) hTF-8. Transferrin–transferrin receptor interaction E. M. Teh et al. 6346 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS consistent with their predicted fusion protein composi- tions (Fig. 3A, lanes 8, 10, 12 and 14; Fig. 4A, lanes 7, 9, 11, 13, 15 and 17). Epitope mapping for mAb F11 Western blot analysis of the different C-lobe fragments with the mAb F11 allowed the determination of the specific region of the C-lobe containing the epitope (Fig. 3B). Full-length hTF was used as a positive con- trol and a bacterial lysate from E. coli transformed with pGEX 4T3 was used as a negative control. In agreement with previous studies, only full-length hTF (lane 2) and the hTF C-lobe (lane 4) fusion protein showed reactivity with the antibody [24]. Following division of the C-lobe into four fragments of approximately 100 residues each, only the hTF-5 fusion protein (lane 5) was positive. This fragment encompasses residues 342–440 of hTF and maps to the amino terminus of the C-lobe contained lar- gely within the C1 domain. To further delineate the region recognized by the mAb F11, additional pGEX 4T3 constructs were made containing deletions from the carboxy-terminal region of the hTF-5 fragment. These constructs (designated hTF-5A to 5F) encompassed residues 342–420. As shown in Fig. 4B, a positive signal was observed with constructs hTF-5B, 5C and 5D (lanes 8, 10, and 12) blotted with the mAb F11 while construct 5A (lane 6) gave only a weak signal. Even at higher concentrations of the hTF-5A bacterial lysates, the intensity of the immunoreactive band did not increase relative to con- structs 5B, 5C and 5D (data not shown). These results suggest that hTF-5A may contain only part of the F11 epitope. The absence of reactivity with the 5E and 5F constructs indicates that these constructs did not con- tain the epitope for the mAb F11. Based on these results, the epitope for the mAb F11 was localized to a region within residues 365–401. A nonspecific band at 66 kDa was observed in all the lanes for the mAb F11 Western blots (Fig. 4B), A B Fig. 4. Western blot analysis of GST–hTF-5 fusion proteins. (A) Western blot analysis using an anti-GST serum before (–) and after (+) induc- tion of the fusion protein. The following expression plasmids were used: (lane 1) hTF; (lanes 2–3) hTF C-lobe; (lanes 4–5) pGEX4T3; (lanes 6–7) hTF-5 A; (lanes 8–9) hTF-5B; (lanes 10–11) hTF-5C; (lanes 12–13) hTF-5D; (lanes 14–15) hTF-5E; (lanes 16–17) hTF-5F. (B) Western blot analysis using the mAb F11 before (–) and after (+) induction of the fusion protein. The following expression plasmids were used: (lanes 1–2) pGEX4T3; (lanes 3–4) hTF C-lobe; (lanes 5–6) hTF-5 A; (lanes 7–8) hTF-5B; (lanes 9–10) hTF-5C; (lanes 11–12) hTF-5D; (lanes 13–14) hTF-5E; (lanes 15–16) hTF-5F. E. M. Teh et al. Transferrin–transferrin receptor interaction FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 6347 including the pGEX 4T3 control. Furthermore, the hTF C-lobe, hTF-5C and hTF-5D (lanes 4, 10 and 12) samples had additional bands at lower molecular weights not seen in the pGEX 4T3 control (lane 2). The intensities of these bands corresponded to the pos- itive reactivity of the target protein and may therefore have been degradation products of the truncated pro- tein. The sensitivity of the anti-GST serum to detect lower concentrations of the target protein is not as great as that of the mAb F11; therefore, it is not sur- prising that the corresponding bands are not seen in the anti-GST blots. As hTF-5E and 5F fusion proteins are short, 23 and 17 amino acid residues, respectively, it could be argued that the absence of positive signal be attributed to protein degradation. However, the GST moiety was detected with the anti-GST serum (Fig. 4A, lanes 15 and 17) and showed the appropri- ate, slight increase in molecular mass corresponding to the theoretical GST C-lobe fusion product, so this possibility seems unlikely. Studies with synthetic peptide To investigate the identity of the F11 epitope further, a synthetic peptide having a short sequence KIECVSAETTEDCI (amino acid residues 365–378 of the C-lobe of hTF) from the positive fusion protein hTF-5B (Fig. 4B, lane 8) was synthesized for use in a competitive immunoassay. Unfortunately, the peptide was insoluble in both reducing and nonreducing aque- ous solutions and this precluded its use in further studies. An alternative approach was used to verify the localized epitope. Crossreactivity of the mAb F11 In previous studies by Mason and Woodworth [24], mAb F11 did not recognize six other mammalian TFs nor oTF. A protein sequence alignment was performed and upon comparison of the amino acid sequences in a region of the putative F11 epitope (residues 365–378, hTF numbering), it was determined that all TFs ana- lyzed had at least one amino acid difference (Table 1). To confirm the mAb F11 epitope, the hTF-5D con- struct, which showed the greatest reactivity with the mAb F11, was mutated at two different residues to mimic the sequence of either pig (T373N) or mouse (V369E) TF. Figure 5A shows expression of the con- structs as detected by the anti-GST serum. Both the hTF-5D T373N (lane 3) and hTF-5D V369E (lane 5) constructs were expressed at a similar level to hTF-5D (lane 1). Neither the hTF-5D T373N (Fig. 5B, lane 4), Table 1. Sequence alignment of TF family members. The alignments were made with BLOSUM 62 score tables with default settings; amino acid numbering is for hTF. Residues that are identical to hTF at the equivalent position are shown by ’ ’. Residue # 365 366 367 368 369 370 371 372 373 374 375 376 377 378 hTF KI ECVSAETTEDCI Pig TF N Mouse TF E Rat TF Q E S Rabbit TF L E P Horse TF N E Q S Bovine TF A E T N E Chicken oTF D V T V V D E K A B Fig. 5. Western blot analysis of the modified hTF-5D GST fusion proteins. (A) Anti-GST blot of the hTF-5D and the modified con- structs before (–) and after (+) induction with IPTG. The following expression plasmids were used: (lane 1–2) hTF-5D; (lane 3–4) hTF- 5D T373N; (lane 5–6) hTF-5D V369E. (B) The F11 blot of hTF-5D and the modified hTF-5D constructs before (–) and after (+) induc- tion of the fusion protein. The following expression plasmids were used: (lane 1–2) hTF-5D; (lane 3–4) hTF-5D T373N; (lane 5–6) hTF-5D V369E. The arrow denotes the position of the GST-5D constructs. Transferrin–transferrin receptor interaction E. M. Teh et al. 6348 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS which resembles the pig TF sequence, nor the hTF-5D V369E (Fig. 5B, lane 6) representing the mouse sequence in the putative epitope region, had a positive immunoreaction with mAb F11 (compare to hTF-5D, Fig. 5B, lane 2). This result is consistent with the earlier mapping of the mAb F11 to a sequence in the C-lobe of human TF while showing no cross-reactivity with pig and mouse TF [24]. Discussion The present study establishes that the epitope of the F11 antibody is in the C-lobe of hTF, specifically within residues 365–401 of the C1 domain. Further- more, binding of the F11 antibody to hTF inhibits binding to TFR (Fig. 1). The residues of TF that are involved in receptor binding have remained elusive, but it has been documented that the C-lobe binds to TFR with a much higher affinity than the N-lobe and mixing of both lobes increases the binding further [15]. Thus, it has been suggested that specific C-lobe resi- dues are critical for establishing contacts with TFR while the N-lobe residues are required for maximal binding [22]. Our goal was to use an epitope mapping study with an antibody known to inhibit binding of hTF to TFR to delineate the residues that comprise the antibody binding site and thus, by extension, the TFR binding site. The E. coli pGEX expression system allows for the production of GST fusion proteins and was used to express the C-lobe of hTF and partial fragments of the C-lobe. Earlier studies have shown that glycosylation of hTF is not important for protein expression [25] and the expression of functional forms of recombinant full-length, N-lobe and C-lobe of human transferrin in E. coli has been demonstrated [26–28]. Thus, a pro- karyotic host was chosen for this study as it provided a simple and cost effective method for analysis with the denaturing conditions used. Although expression of the hTF C-lobe has been shown in various systems, levels are consistently lower than those of the recom- binant N-lobe in eukaryotic cells [1,25,27,28]. It remains unclear why expression of the isolated C-lobe yields low protein production but the large number of disulfide bonds (11 in total) present in the C-lobe is certainly a factor [17]. Another approach for obtaining the C-lobe was recently reported in which a factor Xa cleavage site was introduced into the connecting bridge region of the higher expressing full-length TF [17]. The two lobes were subsequently separated after treatment of the full-length TF with factor Xa. In the current study, we have also obtained expression of the C-lobe of TF although we have not determined whether it assumes a native conformation. It is possible that the 29-kDa GST moiety in this system provides some sta- bilization. Immunoscreening of the GST-hTF C-lobe fragments by Western blot analysis was used to identify the mAb F11 epitope, which was localized to residues 365–401 in the amino-terminal region of the hTF C-lobe. Con- firmation for the identification of this particular region as the mAb F11 epitope came from two observations. First, we have shown that a single amino acid substitu- tion in either one of two residues between positions 365 and 378 abolished the immunoreactivity to mAb F11 (Fig. 5B). The two mutations in this region corres- pond to the amino acid sequences of either mouse (V369E) or pig (T373N) TF, neither of which is recog- nized by the mAb F11. Substitution of a negatively charged glutamyl residue for the hydrophobic valyl residue observed in the mouse sequence abolished all reactivity to the F11 antibody. Furthermore, the fairly conservative T373N substitution observed in the pig TF sequence also resulted in loss of immunoreactivity. An M382V substitution in mouse and pig TF could also contribute to the lack of cross reactivity between species. Antibodies can be exquisitely sensitive to such small changes in sequence [29]. These results provide strong support that the epitope is located within resi- dues 365–401. Second, treatment of hTF with biotin resulted in a preparation of biotinylated hTF that was not recognized by the mAb F11. Biotin binds to lysyl residues and there are lysyl residues at positions 365, 380, and 401. According to the crystal structure of hTF [30], K365 and K380 are located on the surface of the C-lobe and may be attractive targets for the immune system. The crystal structure of hTF also shows that residues 386–401 are buried in the interior of the protein with K401 actually appearing on the opposite face of the protein from the majority of resi- dues in the F11 epitope [30]. Assuming that the F11 antibody is binding to surface residues, it is likely that the epitope is restricted to residues 365–385 of the hTF C-lobe. The mAb F11 blocked binding of hTF to the TFR; this suggests the antibody epitope contains residues that are located in the vicinity of the ligand–receptor interaction. The ability of the F11 antibody to block such binding is likely caused by steric interference. Examination of the recently published pig TF structure shows that the residues in the pig TF sequence equival- ent to 365–372 make up a b-strand [31] and Asn373 of pig TF (Table 1, Thr373 in hTF) lies in a loop follow- ing this strand. As shown in Fig. 6, the putative F11 epitope described in this work maps to a surface on the C1 domain of hTF. A peptide footprinting study E. M. Teh et al. Transferrin–transferrin receptor interaction FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 6349 by Liu and colleagues [23] also predicted the amino acids that comprise part of the F11 epitope to be involved in TFR binding. In their study, oxidative modification of various peptides in the C-lobe of hTF was monitored. Peptides that were oxidized while the C-lobe was isolated but were protected from oxidative modification after the C-lobe had associated with the TFR were suggested to be involved in hTF–TFR association. A region of hTF we have proposed to be involved in TFR binding was shown to be protected from oxidative modification and was thus proposed to undergo a conformational change upon hTF–TFR binding. An elegant study by Cheng et al. [22] des- cribes the structure of hTF complexed with hTFR as determined by cryo-electron microscopy. The authors proposed that a positively charged patch of TFR con- taining many basic residues interacts with a comple- mentary negative patch of hTF containing acidic residues. The F11 epitope described in this study con- tains seven acidic residues, two of which were pro- posed to interact with the TFR (Glu367 and Glu372) [22]. It is possible that the F11 epitope is not within the binding site of TF for the receptor but that binding of the antibody leads to steric hindrance or conforma- tional changes that alter the binding site. However, the agreement of the F11 epitope with the studies of Cheng [22] and Liu [23] argues against this idea. It has been proposed from modelling studies that both the C1 and N1 domains anchor hTF to the TFR [9]. In contrast, the C2 and N2 domains are thought to be the main source of movement about the hinge in response to iron release [9]. Unfortunately, there is no structure available for the iron free form of any mammalian serum TF that would allow assessment of conformational change in this region in response to iron release. One other interesting and potentially relevant observation is that human, mouse, rat and rabbit serum TFs all have an extra disulfide bond com- prised of residues 137 and 331 (human numbering) which restricts access to the hinge region and could have an impact on the stability of the N1 and C1 regions. Bovine, pig and horse TF lack this extra disul- fide bond possibly giving them greater flexibility. Addi- tionally, it may be significant that the epitope is located on the opposite face from the glycosylation site, which has been shown to have no role in receptor binding [25]. Human, pig, rabbit and horse TF bind to human TFR, whereas bovine TF binds very poorly and chicken oTF does not bind at all. This either means that the antibody is more discriminating than the receptor in recognition and ⁄ or there are multiple receptor binding sites that contribute to the overall binding. Until a crystal structure of the TF–TFR com- plex resolves these issues, the current studies highlight an area of hTF that is a strong candidate for partici- pation in the interaction with the receptor. Experimental procedures Materials E. coli strain DH5aF¢ and pBluescript SK – were from Stratagene (La Jolla, CA). E. coli strain BL21 (DE3) was from Novagen (San Diego, CA). The vector pGEX 4T3 used for the expression of the GST fusion proteins, the GST Detection Module (including anti-GST serum) and the chemiluminescence detection kit were from GE Health- care (Piscataway, NJ). Isopropyl-b-D-thiogalactopyranoside (IPTG) and BSA were from the Sigma Chemical Company (Oakville, ON) as were horseradish peroxidase-conjugated immunoglobulins. Human transferrin was from Roche Applied Science (Laval, QC). Immunopure NHS-LC-Biotin and Immunopure avidin-horseradish peroxidase were from Pierce (Rockford, IL). The TMB Microwell peroxidase sub- strate system was from Kirkegaard and Perry Laboratories (Gaithersburg, MD). All other chemicals and reagents were of analytical grade. Milli-Q water was used to prepare all solutions. The F11 and E8 antibodies were a generous gift from Dr James D. Cook and coworkers at the University of Kansas Medical Center in Kansas City, KS. TFR binding studies To examine the ability of various monoclonal antibodies to block binding of hTF to the hTFR on HeLa cells, a limiting amount of 125 I-labelled diferric hTF (20 pmol) was A B Fig. 6. Location of the mAb F11 epitope in hTF. The C1 and N1 domains are highlighted in light grey; C2 and N2 domains are col- oured dark grey. The F11 epitope (residues 365–401), which is in close proximity to the labelled bridge region, is shown in red. The two views are rotated 90° to each other. The coordinates of the monoferric hTF crystal structure were provided by Dr H. Zuccola [30]. Transferrin–transferrin receptor interaction E. M. Teh et al. 6350 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS preincubated with increasing amounts of each antibody (0–80 pmol) at room temperature for 30 min in a total volume of 100 l L. At this time, 300 lL of HeLa cells (1.4 · 10 6 cells) that had been incubated at 37 °C for 20 min with 10 mm NH 4 Cl to inhibit iron removal from the hTF in the subsequent incubations was added to Omni- vials containing the radioiodinated TF and the mAbs. After incubation at 37 °C for 30 min with gentle shaking, por- tions of the cell suspension (three portions, 80 lL each) were washed and assayed as described in detail [15,25]. The results are expressed as the percentage of binding of radio- iodinated hTF to HeLa cells in the absence of added anti- body. Cloning of hTF fragments The hTF cDNA cloned into pUC18 was used as a template for the generation of the hTF N-lobe, hTF C-lobe and four subfragments of the hTF C-lobe designated 5, 6, 7 and 8. Primers used in the PCR amplifications are listed in Table 2. PCR amplifications were performed with VENT polymerase (New England Biolabs, Beverly, MA) in a Per- kin Elmer Cetus DNA Thermal Cycler 480 and consisted of 30 cycles of denaturation at 94 ° C for 1 min, annealing at 54 °C for 1 min and extension at 72 °C for 1 min fol- lowed by a 10-min final extension at 72 °C. Using specific flanking restriction sites listed in Table 2, the PCR products were cloned into pBluescript SK– vector and transformed into E. coli DH5aF¢. To confirm the expected sequences of the constructs and to ensure the absence of mutations introduced during the PCR steps, DNA sequence analysis of positive clones was performed using an ABI Prism Model 310 Genetic Analysis DNA Sequencer (Dr Ivan Sadowski, University of British Columbia, BC). Cloning of hTF fragments into the pGEX 4T3 vector The hTF fragments were subcloned into the pGEX 4T3 vector for the expression of GST fusion proteins. Briefly, the pBluescript–hTF clones were digested with either XhoI and NotI (hTF N-lobe) or BamHI and EcoRI (hTF C-lobe), purified and ligated into the 3¢ end of the GST sequence in the pGEX 4T3 expression vector. The pGEX 4T3 constructs were transformed into E. coli strain BL21 (DE3) (Novagen, Madison, WI) and positive clones were selected by PCR screening and verified by both multiple restriction digests and DNA sequence analysis. Additional pGEX 4T3-hTF-5 based recombinant plas- mids were constructed that contained subfragments of hTF- 5 designated 5A to 5F. These subclones were obtained by PCR amplification using the pGEX 4T3 hTF-5 as a tem- plate, the hTF-5 forward primer and a new reverse primer (Table 2). PCR conditions were 30 cycles of denaturation Table 2. Oligonucleotide primers used to generate the GST–hTF fusion proteins. Synthetic oligonucleotide primers were used to amplify regions of the N- and C-lobes of hTF and clone into the pGEX 4T3 plasmid. pGEX 4T3 clones Primer sequence (5¢fi3¢) a Cloning site hTF ⁄ N-lobe AAA CTCGAGAGTCCCTGATAAAACTGTGAGATG XhoI ⁄ NotI AAA GCGGCCGCTTAGCATGTGCCTTCCCGTAG hTF ⁄ C-lobe AAA GGATCCTGCAAGCCTGTGAAGTGG BamHI ⁄ EcoRI AAA GAATTCATTAAGGTCTACGGAAAGTGCAGG hTF5 b AAAGGATCCATGAAGTGGTGTGCGCTGAG BamHI ⁄ EcoRI AAA GAATTCTTACAGGTGAGGTCAGAAGCTGATT hTF6 AAA GGATCCAATTTTGCTGTAGCAGTGGTGAA BamHI ⁄ EcoRI AAA GAATTCTTAACCTGAAAGCGCCTGTGTAG hTF7 AAA GGATCCCCCAACAACAAAGAGGGATACT BamHI ⁄ EcoRI AAA GAATTCTTAGGTGCTGCTGTTGACGTAATAT hTF8 AAA GGATCCAAGGAAGCTTGCGTCCACAAGATA BamHI ⁄ EcoRI AAA GAATTCTTAGGCAGCCCTACCTCTGAGATTTT hTF5A c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC BamHI ⁄ EcoRI hTF5B c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT BamHI ⁄ EcoRI hTF5C c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA BamHI ⁄ EcoRI hTF5D c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT BamHI ⁄ EcoRI hTF5E c AAAGAATTCTTACCCTACACTGTTAACACT BamHI ⁄ EcoRI hTF5F c AAAGAATTCTTAAACACTCCACTCATCACA BamHI ⁄ EcoRI T373N d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC V369E d GGGAAAATAGAGTGTGAATCAGCAGAGACCACC GGTGGTCTCTGCTGATTCACACTCTATTTTCCC a Restriction sites are underlined. b The forward primer used with the c reverse primers of the hTf5A-5F for PCR amplification. d The muta- genic nucleotides are in bold-type. E. M. Teh et al. Transferrin–transferrin receptor interaction FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 6351 at 94 °C for 30 s, annealing at 54 °C for 30 s and extension at 72 °C for 30 s followed by a final extension at 72 °C for 10 min. Positive clones were selected by PCR screening and sequenced to ensure that no mutations were introduced during the PCR reaction. The QuikChange TM site-directed mutagenesis kit (Strata- gene) was used to introduce the V369E and T373N muta- tion into the hTF-5D construct to resemble mouse and pig transferrin, respectively, in the region of the putative epi- tope (amino acid numbering according to NCBI Accession P02787 with the 19 amino acid hTF signal peptide cleaved so amino acid 1 is the valyl residue of the sequence VPDK). The two sets of complimentary mutagenic primers used are listed in Table 2. The mutagenic reactions were subjected to an initial temperature of 95 °C for 30 s, fol- lowed by 16 cycles of denaturation at 95 °C for 30 s, annealing at 55.8 °C for 1 min and extension at 68 °C for 11 min. The DNA sequences of all clones were determined before the expression studies were performed. IPTG induction of GST-hTF fusion proteins A single colony containing a pGEX 4T3 GST ⁄ hTF recom- binant plasmid was inoculated into Luria broth (LB) con- taining 100 lgÆmL )1 ampicillin and grown overnight at 37 °C. A 100-lL aliquot of the overnight culture was then used to inoculate 1 mL of LB ⁄ ampicillin medium at 37 °C for 3 h. To induce the expression of the GST–hTF fusion proteins, IPTG was added to a final concentration of 1 mm and the cultures were incubated for an additional 3 h at 37 °C. After 3 h, the bacteria were harvested by centrifuga- tion and 200 lLof3· SDS sample buffer was added to the cell pellets. The mixture was then boiled at 95 °C for 5 min to lyse the cells. Gel electrophoresis and western blotting SDS/PAGE was performed using a mini gel apparatus. Equal volumes of the whole cell lysates were resolved on a 12.5% acrylamide separating gel (1 : 29 bis:acrylamide) with a 5% acrylamide stacking gel. Gels were stained with Coomassie Blue to visualize the protein bands. For western blot analysis, the proteins were transferred to a poly(vinylidene difluoride) membrane (Bio-Rad) at 400 mA for 1 h. Following transfer, the membrane was blocked overnight at 4 °C in phosphate buffered saline and 0.02% Tween 20 (NaCl ⁄ P i -T) with 4% BSA. The mem- branes were washed in NaCl ⁄ P i -T and incubated with the monoclonal antibody antihuman F 11 (1 : 20000) or goat anti-GST (1 : 1000) for 1 h at room temperature. Immuno- reactive proteins were visualized using a horseradish per- oxidase-conjugated goat antimouse or donkey antigoat antibody (1 : 20000 for 1 h at room temperature) together with chemiluminescent detection and exposure to Kodak X-Omat XLS Blue film for 30 s. Peptide construction and immunoassay The 14-mer synthetic peptide, KIECVSAETTEDCI, was synthesized by PeptidoGenic Research & Co. Inc. (Liver- more, CA). The lyophilized peptide was insoluble in both reducing and nonreducing aqueous solutions and was not used in further studies. Molecular mapping The coordinates of the monoferric hTF crystal structure were kindly provided by Dr H. Zuccola [30]. The model of hTF showing the F11 epitope was displayed using the pro- gram Swiss-Pdb Viewer, version 3.7 (available online at http://www.expasy.org/spdbv/). Acknowledgements These studies were supported in part by grants from the Canadian Blood Services – Canadian Institutes of Health Research (CBS-CIHR) Research Program in Blood Utilization and Conservation (to R.T.A.M) and the U.S. Public Health Services, National Institutes of Health (NIDDK Grant R01 21739 to A.B.M). E.M.T. was supported by a Postdoctoral Fellowship from CBS-CIHR; T.A.M.G. was supported by a Graduate Fellowship from the Strategic Training Program in Transfusion Science supported by the CIHR and the Heart and Stroke Foundation of Canada. References 1 MacGillivray RTA & Mason AB (2002) Transferrins. In Molecular and Cellular Iron Transport (Templeton, DM, ed.), pp. 41–69. Marcel Dekker Inc., New York, NY. 2 Anderson BF, Baker HM, Dodson EJ, Norris GE, Rumball SV, Waters JM & Baker EN (1987) Structure of human lactoferrin at 3.2-A resolution. Proc Natl Acad Sci USA 84, 1769–1773. 3 Anderson BF, Baker HM, Norris GE, Rumball SV & Baker EN (1990) Apolactoferrin structure demonstrates ligand-induced conformational change in transferrins. Nature 344, 784–787. 4 Bailey S, Evans RW, Garratt RC, Gorinsky B, Hasnain S, Horsburgh C, Jhoti H, Lindley PF, Mydin A, Sarra R & Watson JL (1988) Molecular structure of serum transferrin at 3.3-A resolution. Biochemistry 27, 5804– 5812. 5 Baker EN & Lindley PF (1992) New perspectives on the structure and function of transferrins. J Inorg Biochem 47, 147–160. 6 Aisen P, Enns C & Wessling-Resnick M (2001) Chemis- try and biology of eukaryotic iron metabolism. Int J Biochem Cell Biol 33, 940–959. Transferrin–transferrin receptor interaction E. M. Teh et al. 6352 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 7 Enns CA (2002) The transferrin receptor. In Molecular and Cellular Iron Transport (Templeton, DM, ed.), pp. 71–94. Marcel and Dekker Inc., New York, NY. 8 Turkewitz AP, Amatruda JF, Borhani D, Harrison SC & Schwartz AL (1988) A high yield purification of the human transferrin receptor and properties of its major extracellular fragment. J Biol Chem 263, 8318–8325. 9 Lawrence CM, Ray S, Babyonyshev M, Galluser R, Borhani DW & Harrison SC (1999) Crystal structure of the ectodomain of human transferrin receptor. Science 286, 779–782. 10 Lebron JA, Bennett MJ, Vaughn DE, Chirino AJ, Snow PM, Mintier GA, Feder JN & Bjorkman PJ (1998) Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor. Cell 93, 111–123. 11 Bennett MJ, Lebron JA & Bjorkman PJ (2000) Crystal structure of the hereditary haemochromatosis protein HFE complexed with transferrin receptor. Nature 403, 46–53. 12 Buchegger F, Trowbridge IS, Liu LF, White S & Col- lawn JF (1996) Functional analysis of human ⁄ chicken transferrin receptor chimeras indicates that the carboxy- terminal region is important for ligand binding. Eur J Biochem 235, 9–17. 13 Dubljevic V, Sali A & Goding JW (1999) A conserved RGD (Arg-Gly-Asp) motif in the transferrin receptor is required for binding to transferrin. Biochem J 341, 11–14. 14 West AP Jr, Bennett MJ, Sellers VM, Andrews NC, Enns CA & Bjorkman PJ (2000) Comparison of the interactions of transferrin receptor and transferrin receptor 2 with transferrin and the hereditary hemo- chromatosis protein HFE. J Biol Chem 275, 38135– 38138. 15 Mason AB, Tam BM, Woodworth RC, Oliver RW, Green BN, Lin LN, Brandts JF, Savage KJ, Lineback JA & MacGillivray RT (1997) Receptor recognition sites reside in both lobes of human serum transferrin. Biochem J 326, 77–85. 16 Zak O, Trinder D & Aisen P (1994) Primary receptor- recognition site of human transferrin is in the C-term- inal lobe. J Biol Chem 269, 7110–7114. 17 Zak O & Aisen P (2002) A new method for obtaining human transferrin C-lobe in the native conformation: preparation and properties. Biochemistry 41, 1647–1653. 18 Jeffrey PD, Bewley MC, MacGillivray RT, Mason AB, Woodworth RC & Baker EN (1998) Ligand-induced conformational change in transferrins: crystal structure of the open form of the N-terminal half-molecule of human transferrin. Biochemistry 37, 13978–13986. 19 Bali PK & Aisen P (1991) Receptor-modulated iron release from transferrin: differential effects on N- and C-terminal sites. Biochemistry 30, 9947–9952. 20 Bali PK, Zak O & Aisen P (1991) A new role for the transferrin receptor in the release of iron from transfer- rin. Biochemistry 30, 324–328. 21 Sipe DM & Murphy RF (1991) Binding to cellular receptors results in increased iron release from transfer- rin at mildly acidic pH. J Biol Chem 266 , 8002–8007. 22 Cheng Y, Zak O, Aisen P, Harrison SC & Walz T (2004) Structure of the human transferrin receptor- transferrin complex. Cell 116, 565–576. 23 Liu R, Guan JQ, Zak O, Aisen P & Chance MR (2003) Structural reorganization of the transferrin C-lobe and transferrin receptor upon complex formation: the C-lobe binds to the receptor helical domain. Biochemistry 42, 12447–12454. 24 Mason AB & Woodworth RC (1991) Monoclonal anti- bodies to the amino- and carboxyl-terminal domains of human transferrin. Hybridoma 10, 611–623. 25 Mason AB, Miller MK, Funk WD, Banfield DK, Sav- age KJ, Oliver RW, Green BN, MacGillivray RT & Woodworth RC (1993) Expression of glycosylated and nonglycosylated human transferrin in mammalian cells. Characterization of the recombinant proteins with com- parison to three commercially available transferrins. Biochemistry 32, 5472–5479. 26 Ikeda RA, Bowman BH, Yang F & Lokey LK (1992) Production of human serum transferrin in Escherichia coli. Gene 117, 265–269. 27 Steinlein LM & Ikeda RA (1993) Production of N-term- inal and C-terminal human serum transferrin in Escheri- chia coli. Enzyme Microb Technol 15, 193–199. 28 Hoefkens P, de Smit MH, de Jeu-Jaspars NM, Huijs- kes-Heins MI, de Jong G & van Eijk HG (1996) Isola- tion, renaturation and partial characterization of recombinant human transferrin and its half molecules from Escherichia coli. Int J Biochem Cell Biol 28, 975–982. 29 Prasad L, Sharma S, Vandonselaar M, Quail JW, Lee JS, Waygood EB, Wilson KS, Dauter Z & Delbaere LT (1993) Evaluation of mutagenesis for epitope mapping. Structure of an antibody-protein antigen complex. J Biol Chem 268, 10705–10708. 30 Zuccola HJ (1993) PhD Thesis, Georgia Institute of Technology, Atlanta. 31 Hall DR, Hadden JM, Leonard GA, Bailey S, Neu M, Winn M & Lindley PF (2002) The crystal and molecular structures of diferric porcine and rabbit serum transfer- rins at resolutions of 2.15 and 2.60 A, respectively. Acta Crystallogr D Biol Crystallogr 58, 70–80. E. M. Teh et al. Transferrin–transferrin receptor interaction FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 6353 . EcoRI AAA GAATTCATTAAGGTCTACGGAAAGTGCAGG hTF5 b AAAGGATCCATGAAGTGGTGTGCGCTGAG BamHI ⁄ EcoRI AAA GAATTCTTACAGGTGAGGTCAGAAGCTGATT hTF6 AAA GGATCCAATTTTGCTGTAGCAGTGGTGAA BamHI ⁄ EcoRI AAA GAATTCTTAACCTGAAAGCGCCTGTGTAG hTF7 AAA GGATCCCCCAACAACAAAGAGGGATACT. AAA GGATCCCCCAACAACAAAGAGGGATACT BamHI ⁄ EcoRI AAA GAATTCTTAGGTGCTGCTGTTGACGTAATAT hTF8 AAA GGATCCAAGGAAGCTTGCGTCCACAAGATA BamHI ⁄ EcoRI AAA GAATTCTTAGGCAGCCCTACCTCTGAGATTTT hTF 5A c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC BamHI. EcoRI hTF5E c AAAGAATTCTTACCCTACACTGTTAACACT BamHI ⁄ EcoRI hTF5F c AAAGAATTCTTAAACACTCCACTCATCACA BamHI ⁄ EcoRI T373N d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC V369E d GGGAAAATAGAGTGTGAATCAGCAGAGACCACC GGTGGTCTCTGCTGATTCACACTCTATTTTCCC a Restriction