i chakravarty ak gomes a 2004 quot antisnake venom activity of ethanolic seed extract of strychnos nux vomica linn quot indian j exp biol 42 5 pp 468 75
... median eminence and adenohypophysial concentration of dopamine, serotonin, gamma-aminobutyric acid, taurine and somatostatin in young and aged rats Exp Gerontol 2004, 39: 45- 52 Balsa JA, Sanchez-Franco ... hypothalamic-pituitary axis in pituitary-grafted young female rats J Endocrinol 1981, 144: 156 -164 Esquifino AI, Ramos JA, Tresguerres JAF: Possible role of dopamine in changes in LH and prolactin ... (Barcelona Spain) Animals Adult male Sprague-Dawley rats weighing 300–320 g at the beginning of the experiment were used They were maintained with rat chow and water available ad libitum in a...
... by calpain M Averna et al Fig Identification of NOS–HSP90 association in rat brain and aorta (A) Aliquots (50 0 lg protein) of brain and aorta crude extract, prepared as described in Experimental ... indicate that calpain is activated in both tissues, although at a higher rate in aorta Further direct evidence in support of calpain activation in aorta was provided by the degradation of talin and ... unit of NOS activity was defined as the amount of enzyme producing pmol citrullineÆmin)1 in the specified conditions Separation and quantification of calpastatin species in rat brain and aorta Aliquots...
... gyrase was also in accordance with its low antimicrobial activity (Fig 6B and Table 2) Comparison of the DNA gyrase inhibitory activityof HN with those of ciprofloxacin, LL-37 and ampicillin (an ... 0. 05 is considered as significant Antimicrobial histone H4 peptides Radial diffusion assay The radial diffusion assay of Steinberg & Lehrer [37] was used to confirm the antimicrobial activityof ... important determinant for their antimicrobial activity [24], it was of interest to verify whether HN-like compounds with similar structural arrangements display antimicrobial activity Table indicates...
... iv 5- 1 5- 1 5- 15 5- 15 5-22 5- 25 5- 25 5-31 5- 31 5- 34 5- 36 5- 36 5- 37 5- 40 5- 51 5- 48 5- 48 5- 51 5- 53 5- 53 5- 54 5- 54 5- 55 5-60 5- 60 5- 63 5- 63 CONTENTS (continued) 5. 6.2 Assessment of Causality ... funding provided by the Indoor Air Division within the Office of Air and Radiation's Office of Atmospheric and Indoor Air Programs Steven P Bayard1 was the OHEA project manager with overall responsibility ... conclusions The assessment was prepared at the request of the Indoor Air Division, Office of Atmospheric and Indoor Air Programs, Office of Air and Radiation, which defined the assessment's scope and...
... AGGTGACACTATAGAATACAAGCGTGACTTTGGGTCTT GTACGACTCACTATAGGGACCATTCGCATTAACCAGCTT GTACGACTCACTATAGGGAGGGCTTCACTTCTTGCAAAC AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA AGGTGACACTATAGAATACACACGGCTCACATTGCAT ... AGGTGACACTATAGAATACACACGGCTCACATTGCAT GTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG GTACGACTCACTATAGGGACACGAACAGCAAAGCGA based on the Homo sapien gene sequences adopted from ... A. S.M.; Hamid, A. ; Abd Manap, M.Y Effect of pre-germination time on amino acid profile and gamma amino butyric acid (GABA) contents in different varieties of Malaysian brown rice Int J Food Prop...
... performed a series of total energy calculations considering: (i) single-doped and codoped nanocrystals, (ii) nanocrystals of different sizes, (iii) impurities located in different sites and (iv) variable ... P) impurities Single-doping has been investigated both in spherical and faceted-like Si-nc [13,16] The spherical Si-nc are built taking all the bulk Si atoms contained within a sphere ofa given ... view, a very difficult task For this reason, theoretical/ computational investigations, based on reliable ab-initio DFT approaches, can be of great help to the experimentalists to grow Si-nw suitable...
... 6-3 95) , which is stable up to 400 ◦ C The ratio of (1 1) SnO peak to (1 0) SnO2 peak intensities, as a semiquantitative measure of SnO/SnO2 ratio, are included in Table After calcination at 600 ... growth It is also thought that adding inorganic salts causes to reduce the overall reaction rate and broaden the distribution of product NaBr, NaCl, and NaF as salt-assisted additives are expected ... granular The high sensitivity may be explained in terms of rapid gas diffusion onto the sensing surface In addition, the XRD results reveal the presence ofa stannic suboxide, which explains in...
... d at i o n researchers’ statistical model, rather than a real cause-effect relationship Reanalysis of the ACS data has also shown that considering additional factors in the statistical analysis ... Q Sun, A Wang, X Jin et al., “Long-Term Air Pollution Exposure and Acceleration of Atherosclerosis and Vascular Inflammation in an Animal Model,” Journal of the American Medical Association 294 ... of the data can make the apparent PM2 .5 effect disappear For example, when migration rates into and out of cities was added to the statistical model relating PM2 .5 and premature death, the apparent...
... responsibility for analyzing the data and writing the paper, with all of the authors contributing by reviewing and editing drafts of the manuscript All authors read and approved the final manuscript ... menus with nutritional information actually ordered Ellison et al International Journal of Behavioral Nutrition and Physical Activity 2013, 10:21 http://www.ijbnpa.org/content/10/1/21 Page of Figure ... from 51 menu options Major menu categories included soups and salads, burgers and sandwiches, pasta, vegetarian items, and prime and choice steaks Additionally, diners had the option ofa daily...
... which the electronic trigger was depressed) for each of the three trials and averaged This "absolute error" was used in the data analysis Statistical Analysis A priori statistical power analysis ... remained in position throughout all testing conditions Stimulation consisted ofa 50 A Gaussian white noise signal (zero mean, s.d = 0. 05 mA, 0– 1000 Hz bandwidth) and was controlled via Labview ... subject from sensing motion or feeling pain Additionally, subjects were excluded if they had a history of cardiac arrhythmia, a history of gait or postural disorders, seizures, diabetes, fainting,...
... (L10) As seen in Figure 1, silencing of the gus transgene, leads to an absence of GUS activity, and is accompanied with a strong accumulation of gus specific siRNA This accumulation is maintained ... 0.8 Relative accumulation rRNA Figure Functional amino acids of P1 involved in silencing suppression Functional amino acids of P1 involved in silencing suppression (A) ClustalW alignment of P1 ... significance and sustainable rice production and management strategies J Sustain Agric 1998, 11: 85- 111 Bakker W: Characterization and ecological aspects of Rice yellow mottle virus in Kenya In...
... leukocyte differentiation antigens mAba Isotype of mAb PT8 5A H4 2A TH8 1A5 MSA4 PT9 0A PT81B PIg4 5A PT7 9A DH59B IgG 2a IgG 2a IgG 2a IgG 2a IgG 2a IgG2b IgG2b IgG 2a IgG1 Moleculesb Cell typec MHC class I All ... leukocyte differentiation antigens : A panel of mAbs specifically reactive with porcine leukocyte differentiation antigens is shown in Table The mAbs specific to major histocompatibility complex ... Recently, anionic alkali mineral complex solution, Barodon, was introduced to animal farms to improve the productivity The composition and characteristics of Barodon are based on minerals including Si,...
... a given date during the drying cycle, a transpiration index — considered as a measure of internal plant drought constraint—was calculated at the individual plant level as the ratio ... Specific leaf mass ratio (SLA, dm g and leaf area ratio (LAR, dm -1 ) ) -1 g were calculated as the leaf area to leaf mass and the leaf area to plant mass, respectively partments partitioning was ... et al (1994) and Vivin et al (19 95) Irradiance was outside conditions Average daily temperatures were 26 °C (maximum) and 11 °C (minimum); relative humidity was 70% From 25 August 1993, 15 seedlings...
... of an improved initial reactivity, especially with mature material or determining the culture growth capacities potential for propagation and In oak, BA and the macronutrient composition of the ... or fungi (Bastiaens, 1983) These contaminants make the initial decontamination of the explants difficult Even in apparently healthy cultures, they may reappear after several transfers causing problems ... propagated clone of hybrid walnut (Juglans nigra x J regia) Biol Plant 31, 269-2 75 Moncousin Ch (1980) Micropropagation in vitrode Cynara scolymus: conséquences bactériologiques In: Application...
... CB participated in the study design CB, JC and JPP participated in the acquisition of data CB, JMP, JC and JPP participated in the analysis and interpretation of data CB, JM-P and JPP prepared ... with 3,3'-diaminobenzidine (DAKO Diagnostics Canada Inc., Mississauga, ON, Canada) containing hydrogen peroxide The slides were counterstained with haematoxylin/eosin Statistical analysis Macroscopic ... suggest increased nitric oxide synthesis in rheumatic diseases Ann Rheum Dis 1992, 51 :1219-1222 40 Sakurai H, Kohsaka H, Liu M, Higashiyama H, Hirata Y, Kanno K, Saito I, Miyasaka N: Nitric oxide...
... Determina, tion of pharmacokinetics and pharmacodynamics of flunixin in calves by use of pharmacokinetic/pharmacodynamic modeling American Journal of Veterinary Research 19 95, 56 , 786794 Navarre ... flunixin after administration seem to be similar in ruminants of different species independent on route of administration The absorption was rapid after both intramuscular and oral administrations ... significance these assumed distribution phases was seen also after i. m administration (Fig 1) Flunixin absorption after oral administration was rapid with two Cmax in all individuals (Fig 2) The...
... transmembrane potential and reactive oxygen intermediate production in HIV disease Antioxid Redox Signal 2000, 2 :55 1 -57 3 Fraternale A, Paoletti MF, Casabianca A, Nencioni L, Garaci E, Palamara AT, Magnani ... deacetylation, NF-kappaB and pro-inflammatory gene expression Biochem Pharmacol 2004, 68:1 255 -1267 Garaci E, Palamara AT, Ciriolo MR, D'Agostini C, Abdel-Latif MS, Aquaro S, Lafavia E, Rotilio G: Intracellular ... understood [26] In general, oxidative stress tilts the balance of HAT/HDAC activity towards increased HAT activity and DNA unwinding, thus facilitating the binding of several transcription factors [27]...
... 1 15: 559 -56 6 13 Pelosi P, Croci M, Calappi E, Cerisara M, Mulazzi D, Vicardi P, Gattinoni L: The prone positioning during general anesthesia minimally affects respiratory mechanics while improving ... functional residual capacity and increasing oxygen tension Anesth Analg 19 95, 80: 955 -960 14 Pelosi P, Croci M, Calappi E, Mulazzi D, Cerisara M, Vercesi P, Vicardi P, Gattinoni L: Prone positioning ... in its design and coordination, coordinated the final analysis of collected data, and revised the manuscript in writing its final version All authors read and approved the final manuscript Acknowledgements...