human tumor antigens recognized by t cells and their implications for cancer immunotherapy
Báo cáo y học: " Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression" ppsx
... ctg aac tgg ctg taa ctt ctg c-3’ 6MIEpex2R 5’-tct aag ctt cag caa tcc aat aat tga tg-3’ 6MIEpex3R 5’-cat aag ctt gca tac gtt cct cat tgg at-3’ 6MIEpex4R 5’-cat aag ctt cca aag ttt tga att ctt ... tac ctc ctg ttt ttg agt aag ata tga c-3’ 6MIEpF-165 5’-agt cgg tac cag cta att tcc att cca tat ttg tc-3’ 6MIEpF-102 5’-agt cgg tac cta cag cga ttg gct cct tca tcc tc-3’ 6MIEpR 5’-agt cct cga ... 5’-agt cgg tac cta ctg tgg ttg ggg tct ttc cta c-3’ 6MIEpF-531 5’-acc ggt acc tac cca ggc taa cga gaa cc-3’ 6MIEpF-381 5’-agt cgg tac cac att cct gtt tca tga tgt gta gc-3’ 6MIEpF-214 5’-agt cgg tac...
- 9
- 227
- 0
The Future Isn’t What It Used To Be Changing Trends And Their Implications For Transport Planning doc
... different travel demands than a retired Baby Boomer The Future Isn t What It Used To Be: Changing Trends And Their Implications For Transport Planning Victoria Transport Policy Institute Twentieth ... Trends And Their Implications For Transport Planning Victoria Transport Policy Institute Transportation Options The quality of transport options available tend to affect travel activity: people ... many 21 The Future Isn t What It Used To Be: Changing Trends And Their Implications For Transport Planning Victoria Transport Policy Institute Clive Thompson to Texters: Park the Car, Take the Bus,”...
- 42
- 474
- 0
Báo cáo hóa học: " miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy" docx
... indicate that the tumor- bearing host down-regulates miR-17-92 in T cells (Fig and 4) Interestingly, not only are STAT6-/- T cells resistant to tumor- induced inhibition of miR-17-5p, but CD8 + T cells ... of antiCD3 mAb, suggesting that the miR-17-92 transfection confers T cells with substantial resistance against AICD These findings point to a potential utility for miR-17-92 transfected T cells ... flow cytometry core facility of the University of Pittsburgh Cancer Institute miR Microarray Total RNA was isolated from Th1 and Th2 cells using the Trizol reagent and quality was confirmed with...
- 12
- 381
- 0
ON THE TRANSFORMATION PROCESSES OF THE GLOBAL PULP AND PAPER INDUSTRY AND THEIR IMPLICATIONS FOR CORPORATE STRATEGIES – A European perspective pot
... resources to change the state or condition of something to product output” Mintzberg et al in their article on transforming organizations not propose a definition for transformation, but their study ... aikaisemmat tutkimukset ja kirjallisuus muodostivat tutkimuksen perustan Tutkimuksen tulosten perusteella voidaan todeta, että metsäteollisuuden muutos- ja uusiutumisprosessi on välttäm t ntä kannattavuuden ... yrityksillä ei välttämättä ole resursseja kehittää kaikkia e.m tekijöitä samaan tahtiin, joten yritysten on tehtävä vaikeita valintoja ja priorisoitava kehityskohteensa Lisäksi on todettava, että...
- 219
- 483
- 0
Báo cáo khoa học: "Processes that Shape Conversation and their Implications for Computational Linguistics" pot
... fluent utterances These findings highlight the importance of timing in speech recognition and utterance interpretation The form and length of the reparandum and edit interval bear consequences for ... removed material with pauses of equal length to control for timing In utterances c—h, the reparandum began after the word the and continued until the interruption site (after the unintended color ... with a distinctive intonation that helps listeners distinguish them from the rest of the utterance Fox Tree (1995) found that while previous restarts in an utterance may slow a listener’s monitoring...
- 8
- 354
- 0
Báo cáo y học: "dentification of the prokaryotic ligand-gated ion channels and their implications for the mechanisms and origins of animal Cys-loop ion channels" ppt
... respect to the mechanism by which the binding of the ligand to a segregated site transmits the conformational change to the rest of the LBDs to trigger the rotation Furthermore, the extent of the ... the train of action potentials in the postsynaptic cells Furthermore, within a few milliseconds the neurotransmitter dissociates from the receptor and thereby terminates the synaptic signal Thus, ... architectures suggest that many of the predicted bacterial receptors might possess multiple ligand-interaction domains and that an interplay of allosteric effects could regulate their function...
- 12
- 396
- 0
Báo cáo sinh học: " Complement component C5a Promotes Expression of IL-22 and IL-17 from Human T cells and its Implication in Age-related Macular Degeneratio" potx
... AMD patients and healthy subjects in compliance with institutional review board (IRB) protocols after informed consent at the National Institutes of Health (NIH) The written consents were obtained ... neutralization antibodies Three separate experiments were performed culture and they usually die without stimulation in days We added C5a with or without the C5aR antagonist to the culture for days and ... antagonist Ten separate experiments were performed and the figure shows representative data (C) TUNEL staining of CD4+ T cells treated with or without C5a and C5aR antagonist (D) PBMCs were treated...
- 12
- 389
- 0
Báo cáo y học: "Analysis of the 5''''UTR of HCV genotype 3 grown in vitro in human B cells, T cells, and macrophages" potx
... We are reporting the isolation and replication of HCV from patients infected by type strains of HCV These new isolates can be cultured in both B and T cells By contrast to type strains of HCV, ... 314 T1 and 314 T2 were the same, showing that consecutive transfers of HCV into the same cell type not affect the sequence The 314 T1 and T2 sequences were almost identical to genotype H77, therefore ... CGS TCT ACG AGA C 10.1a Positive 48 71 CTG TGA GGA ACT WCT GTC TTC ACG CRG 10.2 Negative 310 293 CAC TCG CAA GCA CCC TAT CAG 9.1a-flap Positive 24 42 AAT AAA TCA TAA GAC ACT CCA CCA TRG ATC ACT...
- 11
- 276
- 0
Báo cáo y học: " Synergistic effect of human CycT1 and CRM1 on HIV-1 propagation in rat T cells and macrophages" docx
... 5'-ctggaatcacttggcagct- Page of 12 (page number not for citation purposes) Retrovirology 2009, 6:43 gagctctacagagagagtcca-3' and 5'tatggtaccttaagcataatcaggaacatcgtatgggtagtcacacatttcttctgggatttc-3' ... (gccaacgctcaatccggttctcgc) and CTGB3 (gctattttccagctgttctcgagtg) were used for the 5' end Primers CTB4 (ttattccctagtccaaggatgac) and CTGB4 (cagacaatagactatcaagacactgtg) were used for the 3' end PCR was performed ... cDNA in the pCXN2 vector, was used as a template for PCR with forward (5'-ggtctagagcactatggagggagagaggaag-3') and reverse (5'-gggaattcatgcatagtctggtacatcgtaggggtacttaggaaggggtggaagtggtgg-3')...
- 12
- 357
- 0
Báo cáo Y học: Tyrosine sulfation and N-glycosylation of human heparin cofactor II from plasma and recombinant Chinese hamster ovary cells and their effects on heparin binding pot
... lgÆmL)1 human transferrin and antibiotics, and grown to the early stationary phase After two further dilution steps, the cells were finally cultivated for days in serumfree medium supplemented with ... detect only very small amounts of the sulfated molecular ion signal compared to the nonsulfated peptide signal Therefore, the detection and quantitation of polypeptide modification by sulfate ... sequence for tyrosine sulfation [29,30] present in both peptides In addition to the identification of tyrosine sulfate residues detected with the ESI technique, we were also able to identify the dominant...
- 12
- 489
- 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells ... levels and treatment outcome for patients with prostatic cancer and bony metastasis BJU Int 2002, 89:710-713 Stamey TA, Kabalin JN: Prostate specific antigen in the diagnosis and treatment of adenocarcinoma ... in the study were promiscuous Ex Vivo Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination...
- 23
- 439
- 0
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt
... 0.9, by Student’s t- test), and between the RA patient group and the SLE patient group (P > 0.5, by Student’s t- test) Available online http://arthritis-research.com/content/5/2/R91 Flow cytometry ... the age of the RA patient group and the corresponding healthy control group (P > 0.9, by Student’s t- test), between the age of the SLE patient group and the corresponding healthy control group ... of these cells, or blockade in their differentiation Perturbations in the homeostasis of memory T cells may play an important role in the pathogenesis of RA by generating effector cells that can...
- 6
- 323
- 0
Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps
... distinctions still remain between the surface phenotype of TR and primed T cells, but they are more relative than absolute For example, although both primed T cells and TR cells express CD25, the latter ... CCR5 and their human counterparts expressing CCR4 and CCR8 [19,20] Such a distinctive pattern of chemokine receptors suggests that TR cells might be rapidly recruited to sites of inflammation and ... (b) TR cells outcompete TE cells for stimulatory ligands on the APC surface by virtue of their high expression of adhesion molecules (c) TR cells modulate the behaviour of the APC so that they...
- 7
- 576
- 0
Báo cáo y học: "Natural killer T cells and rheumatoid arthritis: friend or foe" ppt
... attracted to synovial tissue and the reason(s) why they get activated locally in the K/BXN serum transfer model to induce TGF-β1 have yet to be elucidated Taken together, the data illustrate the ... by in vivo neutralization studies in which anti-TGF-β1 treatment was shown to abrogate the protective effect of Vαi NKT cells in CD1d–/– mice, while not affecting joint inflammation in wild-type ... interests The author(s) declare that they have no competing interests Acknowledgements DE is supported by the Fund for Scientific Research-Flanders, the Research-Fund of Ghent University and the...
- 2
- 225
- 0
Báo cáo y học: " T cells and post menopausal osteoporosis in murine models" doc
... studies on highly purified BM cells have revealed that ovx increases the production of TNF by T cells, but not by monocytes [13], and that earlier identification of TNF production by monocytes ... antigen presentation by upregulating the production of IFNγ Thirdly, IL-7 and TGFβ inversely regulate the production of each other [25,26] The factors that regulate T cell function and contribute ... homeostasis For example, middle aged women treated with autologous BM transplants develop thymic hypertrophy and a resurgence of thymic T cell output that contributes to the restoration of a wide T cell...
- 4
- 332
- 0
Báo cáo y học: " Lentiviral transduction of Tar Decoy and CCR5 ribozyme into CD34+ progenitor cells and derivation of HIV-1 resistant T cells and macrophages" pdf
... grafts for reconstitution Eight to ten weeks post reconstitution, thus allowing for T cell differentiation, the animals were sacrificed and thymocytes were isolated from the grafts The differentiated ... against HIV1 infection These results showed for the first time that expression of these transgenes in combination not interfere with normal thymopoiesis and thus have set the stage for their ... Reverse Tar: 5'-CTTGCTCAGTAAGAATTTTCGTC HIV-1 infection of thymocytes Thymocytes derived from thy/liv grafts of SCID-hu mice were sorted by FACS to enrich for EGFP expressing cells (>90% purity) They...
- 11
- 264
- 0
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx
... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures, and ... with CHO/EGFP cells (C) Representative FACS scatter plots of apoptotic CD3 +T cells 72 h after co-culture with CHO cells transfected with IDO (D) Representative FACS scatter plots of apoptotic ... of patients with breast cancer showed that a significantly higher proportion of CD3 +T cells were apoptotic than in the control group, suggesting that IDO may affect the T cell proliferation and...
- 10
- 299
- 0
Báo cáo y học: "New role for Agrin in T cells and its potential importance in immune system regulation" ppsx
... importance of the actin cytoskeleton in the spatiotemporal formation of the IS and T cell activation [33] Nonetheless, there is still a lot to be learned about the function of Agrin in T cells Its ... antigen presentation; and to identify the receptor(s) that mediate the effects of Agrin in immune cells At the organism level, vital information will be generated by: studying how T cells and the ... as yet unknown modification of Agrin that endows it with higher aggregating activity, and furthermore redistributes the protein to the site of the IS where it may facilitate antigen presentation...
- 7
- 357
- 0
Báo cáo y học: "Effects of cigarette smoke on degranulation and NO production by mast cells and epithelial cells" pot
... sense: 5'-TACCAGCCGGGGGACCAC-3', antisense: 5'-CGAGCTGAC-AGAGTAGTA-3' sense: 5'-GAGCTTCTACCT-CAAGCTATC-3', antisense: 5'-CCTGATGTTGCCATTGTTGGT-3'; sense:5'-GCACAGGAA-ATGTTCACC TAC-3', antisense: ... 5'-CACGATGGTGAC-TTTGGCTAG-3' sense: 5'-CAGCTGGGCTGTACAAACCTT-3', antisense: 5'-CATTGGAAGTGAAGCGTTTCG-3', 5'6FAM (fluorescent reporter dye, 6-carboxyfluorescein)-CGGGCAGCCTGTGAGACCTTTGA-TAMRA (quenching ... burned for min, and cigarettes were used for each millilitre of the appropriate medium for different cells The pH of the resultant extract was titrated to pH 7.4, and diluted with medium Solutions...
- 9
- 325
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25