hoa live 1 in hue last year but now she 2 live in hanoi yesterday hoa s friend nien 3 send hoa a letter nien 4 be hoa s neighbor when hoa lived in hue she 5 be younger than hoa
ĐỒ ÁN CHI TIẾT MÁY ĐỀ SỐ 4: THIẾT KẾ HỆ DẪN ĐỘNG BĂNG TẢI Thông số đầu vào : 1. Lực kéo băng tải F = 2200 N 2. Vận tốc băng tải v =0,87 ms 3. Đường kính tangD = 190 mm 4. T
... ngang 0xz) + Biểu đồ momen xoắn T z Ft2=6 74 ,22 FY4 =18 3, 38 x y Fa2 = 23 8,07 lc 22= 66 Fkn = 12 0,07 Fr2 =59 , 53 l 22= 75 l 21 = 20 7 FX4 =2 71, 58 Fx2 =28 2 ,57 Fy2 = 12 3, 85 3 729 9 7 9 25 My 16 34 8 Mx 13 7 54 21 0 766 T 24 ... 0 , 25 .3 ,2/ (2 – 0 , 25 ) = 1, 4 với ổ đ a → ta : KHβ = 1, 13 + T1 = 3 6 12 2 Nmm - mômen xoắn trục I + [σH] =4 81, 82 MPa Vậy : chiều dài côn s Re là: R e = 50 42 +1 54 9 59 .1, 13/ [ (1- 0 , 25 ).0 , 25 .4. 4 81, 822 ] = 14 6 ,20 (mm) ... 628 0 7606,6 10 0 52 ,1 1 25 60 a Wo 16 54 8 ,4 6 ,48 1, 04 σm S 10 ^6 14 ,68 8 ,39 6 ,37 91, 46 τm a 10 ,48 10 ,48 8 ,39 6 ,37 S S 7, 04 7, 04 8, 82 11 ,6 7 , 45 11 ,5 PHẦN TÍNH CHỌN VÀ KIỂM NGHIỆM Ổ LĂN 5 .1 Chọn ổ lăn...
- 39
- 2,317
- 1
Appropriateness of the textbook American Headway 1 for the first year students at Ho Chi Minh City University of Industry based in Thanh Hoa province.PDF
... Textbooks help to standardize instruction and assessment That is, by giving students in different classes the same textbook, teachers can teach and test them in the same ways (Richards 20 05) The ... procedures Chapter deals with data analysis and some suggestions Part C (Conclusion) summaries the study and offers some suggestions for further research 42 REFERENCES Ali Jahangard (20 07), Evaluation ... Summary……………………………………………………………………… 23 Chapter 4: Findings and Discussion………………………………… 24 4 .1 Data and data analysis …………………………………………………… 24 v 4 .1. 1 Survey questionnaires……………………………………………………… 24 4 .1. 2 Interview……………………………………………………………………...
- 12
- 434
- 1
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc
... 51 6 .5 1/ 50 000 36 .1 1 01. 3 1. 8 1. 1 16 2. 2 14 2. 6 1/ 20 000 56 .8 11 3. 8 3 .1 1.8 16 1 .1 1 45 .1 1 /10 000 58 .7 12 5 .1 3. 7 1. 8 18 3. 7 19 7.9 1/ 50 00 41 . 3 86 .3 5 .2 2 .2 16 3. 6 19 9 .1 1 /10 00 46 .1 98.0 17 .8 12 .3 16 8 .1 2 21 . 7 ... 3 / 12 NA NA 10 0,000 93, 3 34 8 ,40 0 12 / 12 93% 9% 10 ,000 10 , 53 3 2, 0 01 12 / 12 10 5% 19 % 1, 000 1, 0 35 13 4 12 / 12 10 3% 13 % 10 0 10 9 41 . 4 12 / 12 10 9% 38 % 10 14 NA 10 / 12 NA NA NA 3 / 12 NA NA CD8 NA, not applicable ... results/total 12 tests % Recovery %CV 12 / 12 10 0,000 10 4, 50 8 15 ,676 12 / 12 10 5% 15 % 10 ,000 9,0 32 1, 1 74 12 / 12 90 .3% 13 % 1, 000 9 42 19 8 12 / 12 94 .2% 21 % 10 0 80 27 .2 12 / 12 80% 34 % 10 10 NA 8 / 12 NA NA 1 NA 3 / 12 ...
- 25
- 639
- 0
báo cáo hóa học:" Epigenetic control of the ubiquitin carboxyl terminal hydrolase 1 in renal cell carcinoma" doc
... molecular- Page of (page number not for citation purposes) Journal of Translational Medicine 20 09, 7:90 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 based diagnosis of medullary thyroid ... and antisense: 5' -AAA AAC AAA TAC AAA AAA AAA AAC AAA ACC -3' ) using 1/ 5th of the first PCR product using the same PCR conditions, but extended to 30 cycles Subsequently, 20 -50 ng of the resulting ... Nagasaka T, Nakao A: PGP9 .5 as a prognostic factor in pancreatic cancer Clin Cancer Res 20 00, 6 :47 64- 4767 Takase T, Hibi K, Yamazaki T, Nakayama H, Taguchi M, Kasai Y, Ito K, Akiyama S, Nagasaka...
- 9
- 724
- 0
báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf
... Cnr1+/+ ipsilateral 13 ,7 73 ± 0 ,5 92+ + 25 ,27 7 ± 1, 4 03* * 16 ,6 21 1 ,46 5 16 6 21 ± 46 5+ + Cnr1-/contralateral 12 , 0 13 ± 0 ,48 9 13 ,22 3 ± 0,788 15 ,909 2, 32 7 15 909 ± 32 7 Ipsilateral 20 , 028 ± 1, 25 7## 21 , 3 41 ... multiple sclerosis reveals a Mestre et al Journal of Neuroinflammation 2 011 , 8 :10 2 http://www.jneuroinflammation.com/content/8 /1/ 1 02 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 Page 13 of 13 therapeutic ... production in astrocytes Glia 20 03, 44 : 85- 90 Stella N: Endocannabinoid signaling in microglial cells Neuropharmacology 20 09, 56 : 24 4 - 25 3 Mechoulam R, Shohami E: Endocannabinoids and traumatic brain injury...
- 13
- 466
- 0
báo cáo hóa học: " Participation of MCP-induced protein 1 in lipopolysaccharide preconditioning-induced ischemic stroke tolerance by regulating the expression of proinflammatory cytokines" pdf
... ischemia Nat Med 20 03, 9: 11 80 -11 86 41 Wellen KE, Hotamisligil GS: Inflammation, stress, and diabetes J Clin Invest 20 05, 11 5: 11 11- 111 9 25 Figure Legends Figure MCPIP1 mRNA and protein levels are ... Nat Med 20 09, 15 :19 2 -19 9 Minami M, Katayama T, Satoh M: Brain cytokines and chemokines: roles in ischemic injury and pain J Pharmacol Sci 20 06, 10 0 :4 61 47 0 Haines BA, Mehta SL, Pratt SM, Warden ... Exp Med 2 010 , 20 7: 29 59 -29 73 17 Matsushita K, Takeuchi O, Standley DM, Kumagai Y, Kawagoe T, Miyake T, Satoh T, Kato H, Tsujimura T, Nakamura H, and Akira S: Zc3h1 2a is an RNase essential for...
- 38
- 422
- 0
báo cáo hóa học: " Pharmacological inhibition of Akt and downstream pathways modulates the expression of COX-2 and mPGES-1 in activated microglia" potx
... glycogen synthase kinase beta ameliorates liver ischemia reperfusion injury by way of an interleukin -10 -mediated immune regulatory mechanism Hepatology 2 011 , 54 : 687-696 13 17 18 19 20 21 22 23 24 25 ... 20 09, 21 : 26 42 7 3 Takada Y, Fang X, Jamaluddin MS, Boyd DD, Aggarwal BB: Genetic deletion of glycogen synthase kinase-3beta abrogates activation of IkappaBalpha kinase, JNK, Akt, and p 44/ p 42 MAPK but ... Keywords: microglia, phosphatidylinositol 3- kinase, mammalian target of rapamycin, glycogen synthase kinase -3, Akt, prostaglandins FINDINGS Inflammation has been recognized not only as a mere bystander...
- 20
- 413
- 0
Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx
... (page number not for citation purposes) Virology Journal 20 07, 4 :10 6 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Salahuddin SZ, Rose RM, Groopman JE, Markham PD, Gallo RC: Human T lymphotropic ... (ARC) and from healthy carriers: a study of risk groups and tissue sources Proc Natl Acad Sci U S A 19 85, 82 (16 ) :5 53 0 -5 5 34 Salahuddin SZ, Ablashi DV, Markham PD, Josephs SF, Sturzenegger S, Kaplan ... chimpanzee J Virol 20 03, 77 (3) :22 33 -22 42 Mirandola P, Menegazzi P, Merighi S, Ravaioli T, Cassai E, Di Luca D: Temporal mapping of transcripts in herpesvirus variants J Virol 19 98, 72( 5) :38 37 -38 44 ...
- 8
- 446
- 0
Báo cáo hóa học: " Human Immunodeficiency Virus type 1 in seronegative infants born to HIV-1-infected mothers" doc
... E9USA 10 0 99 P1b P 1a VE25AVenezuela MexP2.2PBMCclone2 consensusC 10 0 consensusE HIV-1pCM 2 35 -4USA consensusA URTR35Uruguay 10 0 ARMA 159 Argentina URTR23Uruguay 0. 02 Phylogenetic relationship of LTR sequences ... polymerase PCR amplifications were used (GAG and nef/LTR) The initial amplification of DNA was performed using GAG1-GAG2 (5' TCCACCTATCCCAGTAGGAG3' and 5' GGTCGTTGCCAAAGAGTGAT3') or LTR1-LTR2 primers ... hu-PBL-SCID Mice AIDS Res Hum Retroviruses 20 00, 16 :4 41 - 4 52 Wu Y, Marsch JW: Selective Transcription and modulation of resting T cell activity by preintegrated HIV DNA Science 20 01, 29 3 : 15 03 - 15 06...
- 6
- 378
- 0
Báo cáo y học: "Endothelin-1 enhances fibrogenic gene expression, but does not promote DNA synthesis or apoptosis in hepatic stellate cell" doc
... 72 hr (%) 12 0 hr (%) 16 8 hr (%) 38 .8 ± 7 .5 37 .3 ± 9 .3 31 . 9 ± 9.9 40 .2 ± 6.6 42 . 4 ± 4. 6 40 .1 ± 5. 5 55 .6 ± 10 .0 56 .3 ± 8.0 53 . 3 ± 11 .3 40 .2 ± 3 .2 35 .3 ± 4. 4 36 .7 ± 5. 8 46 .9 ± 5 .2 46 .9 ± 3. 4 55 .4 ... probe: -TTC TGC AAC TCG GAC CTG GTT ATA AGG-; TGFβ -1 (accession no X 5 24 98) sense: -AGAAGTCACCCGCGTGCTAA-, antisense: -TCCCGAATGCTCGACGTATTGA-, probe: ACCGCAACAACGCAATCTATGACAAAACCA-; MMP -2 (accession ... Hepatol 19 97, 27 : 42 4 - 42 5 Taieb J, Mathurin P, Poynard T, Gougerot-Pocidalo MA, Chollet-Martin S: Raised plasma soluble Fas and Fas-ligand in alcoholic liver disease Lancet 19 98, 3 51 : 1 930 -19 31 Saile...
- 12
- 283
- 0
Structures for writing task 1 in IELTS
... describing the lowest point The number of students hit a trough/plunged to a trough of 20 00 For describing a fluctuation The number fluctuated between and The number fluctuated wildly around and ... number fluctuated between and The number fluctuated wildly around and Some words for describing “approximately” About/around/approximately/well over/roughly ...
- 2
- 3,445
- 161
Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"
... 19 94; 18 (3) :2 51 - 25 5 11 Sack JS, Andrews LC, Magnus KA, Hanson JC, Rubin J, Love WE Location of amino acid residues in human deoxy hemoglobin Hemoglobin 19 78; 2( 2): 15 3 -16 9 12 Perutz MF, Lehmann H ... Birmingham 12 0 (H3) Ala ->Glu Ann clin biochem 19 74 ;11 : 53 - 55 Molchanova TP, Pobedimskaya DD, Huisman THJ The differencs in quantities of 2- and 1- globin gene variants in heterozygotes Br J Haematol .19 94; ... Haematol .19 94; 88: 30 0 -30 6 Harano T, Harano K, Imai K, Yunoki H, Yagi H, Nagashima K, Kuroume T Hb J-Meerut [ 12 0 (H3) Ala ->Glu] found in a Japanese family Hemoglobin 19 89; 13 (2) : 16 9 -17 5 Yalçin...
- 2
- 503
- 0
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"
... R :5' -ttgggtaagaggctgtttttcggggacaggaacagc -3' PKA A5 68T _A5 71G F :5' -ctgttcctgtccccgaaaatcagcctcttacccaacac -3' R :5' -gtgttgggtaagaggctgattttcggggacaggaacag -3' F :5' -aacaacctcttacccaacaccagcgccctatccaaaacc -3' R :5' -ggttttggatagggcgctggtgttgggtaagaggttgtt -3' ... R :5' -gctgctcagattcagcaagtcgtcaaagactttgcactgg -3' F :5' -ctttgctgttcctgtccccgaaaagacacctcttacccaacacca -3' R :5' -tggtgttgggtaagaggtgtcttttcggggacaggaacagcaaag -3' F :5' -ttcctgtccccgaaaaacagactcttacccaacaccaagg -3' ... A5 68G_C56 9A_ A570C_ A5 71G_C57 2A A589G_G59 0A_ G591C A5 89G_G59 0A_ G591C F :5' -gccccagtggaggatttacgcatatgccggcgaca -3' R :5' -tgtcgccggcatatgcgtaaatcctccactggggc -3' F :5' -ccagtgcaaagtctttgacgacttgctgaatctgagcagc -3' R :5' -gctgctcagattcagcaagtcgtcaaagactttgcactgg -3' ...
- 9
- 592
- 0
Tài liệu Evidence-based Series 15-1 IN REVIEW : Screening for Skin Cancer doc
... melanoma, basal cell carcinoma, and squamous cell carcinoma of the skin be offered surveillance by a physician, including total-body skin examination and counselling to perform skin self-examination? ... protection and skin cancer awareness in outdoor workers in Israel Cancer Causes Control 20 00 ;11 (6): 5 13 - 21 Berwick M, Begg CB, Fine JA, Roush GC, Barnhill RL Screening for cutaneous melanoma by skin self-examination ... What characteristics should clinicians assess in order to determine risk for melanoma, basal cell carcinoma, and squamous cell carcinoma of the skin? Recommendations Very limited evidence was available...
- 5
- 379
- 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... Identification and expression of a cDNA encoding human 6 622 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 a- amino-b-carboxymuconate-e-semialdehyde decarboxylase (ACMSD) J Biol Chem 27 7, 3 51 6 2 3 51 6 7 Tanabe ... human ACMSD 10 11 12 13 14 15 16 17 18 19 20 S Garavaglia et al compounds in K5 62 cells but not in normal human lymphocytes Biosci Biotechnol Biochem 64, 11 42 11 46 Fernandez-Pol JA, Klos DJ & Hamilton ... b)8 barrel domain and a small insertion domain (Fig 2) hACMSD and PfACMSD can ˚ indeed be superposed with an rmsd of 1. 6 A based on 32 6 Ca pairs hACMSD folds into 12 a- helices, 11 b-strands and...
- 9
- 796
- 0
Tài liệu Báo cáo khoa học: Role for nectin-1 in herpes simplex virus 1 entry and spread in human retinal pigment epithelial cells docx
... 79, 13 1 73 13 179 17 Tiwari V, Shukla SY, Yue BY & Shukla D (20 07) Herpes simplex virus type entry into cultured human 52 8 4 18 19 20 21 22 23 24 25 26 27 28 29 30 31 corneal fibroblasts is mediated ... HVEM; 5 -TCCTTCACCGATGGCACTATCC -3 and 5 -TCAACACCAGCAGGATGCTC -3 for nectin -1; and 5 -AGAAGCAGCAGCACCAGCAG -3 and 5 -GTCACG TTCAGCCAGGA -3 for nectin -2 The 3- OST -3 sequences were amplified using 5 -CAGGCCATCATCATCGG -3 ... described with serial dilutions of HSV -1( KOS) gL86 As stated before, a spectrophotometer (Molecular Devices) was used to measure b-galactosidase activity at 41 0 nm Statistical analysis Data are...
- 14
- 672
- 0
Tài liệu Báo cáo khoa học: Caveolin-1 influences P2X7 receptor expression and localization in mouse lung alveolar epithelial cells docx
... 30 21 30 33 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 30 31 Caveolin -1 and P2X7 expresssion in lung cells 10 11 12 13 14 15 16 17 18 19 20 K Barth et al topology of an ATP-gated ion channel ... shRNAcontrol1 (TAGCGACTAAACACATCAA), shRNAcontrol2 (TATA GCGACTAAACACATCAA) and shRNAcontrol3 (AAAG AGCGACTTTACACACTT) were designed All constructs were verified by sequencing shRNA-expressing lentiviruses ... distinguishable punctate patterns of Caveolin -1 staining were found (Fig 5A) P2X7 staining appeared as small punctate spots at the FEBS Journal 27 4 (20 07) 30 21 30 33 ª 20 07 The Authors Journal...
- 13
- 440
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... 5 -UAUAAGAGUCAGUACACAUCAUGGAAG -3 , antisense, 3 -UAAUAUUCUCAGUCAUGUGUAGUACCU -5 Another HO -2- specific siRNA, HO -2 siRNA1 (target base 21 2 23 2) reported by other investigators [ 32 ] , was also used ... Japan), and scrambled HO -2 siRNA was used as a negative control: HO -2 siRNA: sense, 5 -AGGACUUCUUGAAAGGCAA CAUUAAAG -3 , antisense, 3 -UAUCCUGAAGAACUU UCCGUUGUAAUU -5 ; scrambled HO -2 siRNA: sense, 5 -UAUAAGAGUCAGUACACAUCAUGGAAG -3 , ... FEBS Journal 27 3 (20 06) 53 3 3– 5 34 6 ª 20 06 The Authors Journal compilation ª 20 06 FEBS Y Ding et al 24 25 26 27 28 29 30 31 32 33 34 35 36 Yoshida T (19 95) Heme oxygenase -2 Properties of the heme...
- 14
- 487
- 0
Báo cáo khoa học: Effect of priming on activation and localization of phospholipase D-1 in human neutrophils potx
... phosphohydrolase: effect of cationic 27 64 K A Cadwallader et al (Eur J Biochem 2 71) 23 24 25 26 27 28 29 30 31 32 33 34 35 amphiphilic drugs and divalent cations Arch Biochem Biophys 25 3, 4 53 4 61 L’Heureux, ... primer sets specific for PLD1 (sense: 5 -ATGAGACACCCGGATCATGT; antisense: 5 -ACT CACTGGACGGGTGAAAG; 49 6 bp product) and PLD2 (sense: 5 -CTGCACCCCAACATAAAGGT; antisense: 3 -GTTCTCCAGAGTCCCTGCTG; 5 94 ... were also measured across a range of brefeldin A (0 30 0 lgÆmL )1) and wortmannin (0 10 0 nM) concentrations (inserts in Fig 3) These results indicate that PI3-kinase-sensitive and brefeldin A- sensitive...
- 10
- 468
- 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx
... T, Schultz J, Ponting CP & Bork P (20 04) SMART 4. 0: towards genomic data integration Nucleic Acids Res 32 , Database issue, D1 42 14 4 FEBS Journal 27 2 (20 05) 35 05 3 51 1 ª 20 05 FEBS Sequence analyses ... proteins of Drosophila: trans-regulators of homeotic gene function Annu Rev Genet 29 , 28 9 30 3 FEBS Journal 27 2 (20 05) 35 05 3 51 1 ª 20 05 FEBS A M Rojas et al 12 Shearn A (19 89) The ash -1, ash -2 and ... cells, showing lagging chromosomes during anaphase (arrowhead) FEBS Journal 27 2 (20 05) 35 05 3 51 1 ª 20 05 FEBS The complete protein sequences of human DIDO isoforms and were searched against PFAM [22 , 23 ]...
- 7
- 658
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose