... ΔΨm 5’-RACE β2m mitochondrial membrane potential 5'-rapid amplification of cDNA ends β2-microglobulin aa AAH AFP ALAS ANOVA ATP amino acid atypical adenomatous hyperplasia α-fetoprotein δ-aminolevulinate ... 1):1316-1325 46 Takayama T, Makuuchi M, Hirohashi S, Sakamoto M, Okazaki N, et al Malignant transformation of adenomatous hyperplasia to hepatocellular carcinoma Lancet 1990;336:1150-1153 17 47 Sakamoto ... Chijiiwa K, Nakano K, Kameoka N, Nagai E, Tanaka M Proliferating cell nuclear antigen, plasma fibronectin, and liver regeneration rate after seventy percent hepatectomy in normal and cirrhotic rats...
... and characterization of anovel zinc finger protein that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization ... E B AAAAAAAA C A B D AAAA B A 71 47 217 42 S S M S 1 – – – 25 – B A C A 67 130 160 98 S S M M – – – 13 30 AA B B Accession no in the NCBI protein database proteins Filamentous proteins ... 2005 FEBS M Segawa et al Interchromatin space protein ISP36 A B Fig Subcellular localization of ISP36 (A) Rat liver cytosol (A1 ), microsome (A2 ), mitochondria (A3 ) and nuclear (A4 ) fractions were...
... complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs ... each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢ Actin fractionation ... direct manner Formation of higher order actin structures, such as bundles and cables, is crucial to stabilize the organization of transvacuolar strands and maintain overall cellular architecture As...
... Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A. , Saito, Y., Nakao, K., Jockusch, B.M & Narumiya, S (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, is a target protein ... Nakano, T., Okawa, K., Iwamatsu, A & Kaibuchi, K (1996) Rho-associated kinase, anovel serine/threonine kinase, as a putative target for small GTP binding protein Rho EMBO J 15, 2208–2216 Nakagawa, ... Mukai, H., Ono, Y., Chihara, K., Matsui, T., fHamajima, Y., Okawa, K., Iwamatsu, A & Kaibuchi, K (1996) Identification of a putative target for Rho as the serine-threonine kinase protein kinase...
... gaggctgccctgcgctccgctttgctttgggattaatttattctgcatct gctgagaggggcaccccagccatatcttacactttggtaaagcagaaaac caggaaaattttcttaaaatatccacaatattccttgagtgagtcagaat ctatagccggttagtgatggtttcaggcagaatcgtgttcgtgtctgttt tgctcgattcctttcctaagttaaataaatgcaagcctctgaacttctgt ... aaaaaacaaccatttcctctctgctgagagccagggaaggcgagctctgc gcacacgggcgtccctgcagcagccactctgctttccaggaccggccaac tgccctggaggcatccacacaggggcccaggcagcacagaggagctgtga acccgctccacaccggccaccctgcccggagcctggcactcacagcaggc ... GCGCGCTTTCGCCGTGGGCTGGACAATGACTACGTGGAGTCACCATGCTG A R F R R G L D N D Y V E S P C * Agtcgcccttctcagcgttccatcgatgcacacctgctatcgtggaacag cctagaaaccaagggactccaccaccaagtcacttcccctgctcgtgcag aggcacgggatgagtctgggtgacctctgcgccatgcgtgcgagacacgt...
... non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads that did not match any of those ... correspond to any annotated small RNA Our small RNA cloning strategy only captures small RNAs that are, as miRNAs, 5’-phosphorylated and, Page of 13 thus, eliminates RNA degradation products generated ... data analysis Color-space reads were matched against annotated databases using the Small RNA Analysis Pipeline Tool v5.0 (RNA2MAP), provided by Applied Biosystems, using the following parameters:...
... Abbreviations aa amino acid ACTH adrenocorticotropic hormone AMPK AMP-activated Protein Kinase AOX coenzyme A oxidase AP-1 adaptor protein- 1 ARF ADP ribosylation factor Arg arginine ARNO ARF nucleotide ... CCC AGC CGG AAG AAG-3’ and 5’-CGC GTC GAC CAC AAT GAT GTC ATA GAC-3’ and digested with BamHI-SalI and ligated to C-terminal of EcoRI-BamHI fragment in pUC19 The full length of BIG3 at EcoRI-SalI ... pair: 5’-GCC GAA TTC CCA GAT GCT AAA GAA G-3’ and 5’-TAT GTC GAC AGG CCT GAG AGA TCC A- 3’ The PCR product was digested by EcoRI-SalI and ligated into pET-41b(+) vector His-BIG1Sec7 was generated...
... phosphorylation catalyzed by a newly isolated enzyme, phosphorylase kinase (a protein kinase) Phosphorylase a can be inactivated by dephosphorylation catalyzed by aspecific phosphatase Many kinases have ... acids are either saturated or unsaturated In the membrane, stearic acid and palmitic acid are the most common saturated fatty acids254 The most common unsaturated fatty acid is oleic acid Arachidonic ... identified as protease-activated serine/threonine kinases via conventional protein chemistry and were originally named protease-activated kinases (PAK) It was isolated from rat liver and was shown...
... TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT ... genomic DNA contamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5¢-ATCACCATCGGCAACGAGAG-3¢ and 5¢-TGGAGTTGTAGGTGGTCTCGTG-3¢)...
... were extracted, and the target ZI3 1A gene was amplified by PCR with primers 5¢-AAATA TAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGC GTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by ... Gccyto–Fc fusion protein and several membrane-localized Z-domain variants as interaction models with a wide range of affinity constants with the same genotypes as the parental strains (Table 1) Using ... other contained a minor amount of signal-amplifiable target strain (FG1; ZI3 1A Fc) and an excess amount of signal-amplifiable nontarget strain (FG0; None–Fc) Several mixing ratios were used, as shown...
... hydrolases (Fig 3) These enzymes share a functional catalytic triad made of a catalytic nucleophile serine, associated to a proton carrier histidine and a charge relaying aspartic (or glutamic) acid ... composed of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered ... 5¢-gcgccaatcctggacgctgacgtcatcgacgcg-3¢ (forward) and 5¢-cgcgtcgatgacgtcagcgtccaggattggcgc-3¢ (reverse) The bases in bold indicate the location of the mutation DNA sequence of the mutant was confirmed by DNA...
... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... that DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, long regions ... transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain showing the same...
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... stabilize ARE-containing mRNAs [68] and has been associated with the activation of c-Jun N-terminal kinase (JNK) [69] Similarly, activation of MAP kinase-activated protein kinase has been associated ... ice-cold NaCl/Pi and cellular RNA was extracted using the RNeasy Total RNA kit (Qiagen) Five micrograms of total RNA per lane were separated in 1.2% (w/v) agarose/2.2 M formaldehyde gels and transferred...
... C-terminal Caskin1 are functional and may interact with SH3 domain-containing proteins, such as Abi2 [We have also found an in vivo association and colocalization of Abi2 with Caskin1 (A Balazs, ... buffer spectrum and averaging 10 separate scans Gel filtration chromatography The unfolded nature of PRD and its fragments was also characterized by gel filtration chromatography The proteins (200 ... proteolysis [5] At typical protease concentrations at which globular proteins are hardly affected, these proteins are degraded rapidly and completely In accordance with this, PRD-His shows a greater sensitivity...
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... Mountain View, CA, USA), and poly (A) + RNA was isolated using Oligo(dT)-Latex Super (Takara Shuzo Co.) cDNA was prepared from mRNA with a Zap-cDNA synthesis kit (Stratagene, La Jolla, CA, USA) according ... to underwater material surfaces was analyzed by: (a) quantitative amino acid analysis; and (b) SPR Protein adsorption to glass and a positively charged polymer were evaluated by quantification of...
... site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA G-3¢ and 5¢-CTT AGG AGA TGT AGG ACC CAG TGT CCT TTT G-3¢) To create pStrep–BroxC408S ... AAA GAC CCC AAC GAG AAG CGC GAT CAC-3¢ and 5¢-GTG ATC GCG CTT CTC GTT GGG GTC TTT GCT CAG CTT GGA CTG-3¢) pmGFP–Brox C408S , which has a point mutation at amino acid 408, was created by PCR-based ... vacuolar protein sorting factors by using alternative adaptor proteins Proc Natl Acad Sci USA 100, 12414–12419 29 Ichioka F, Horii M, Katoh K, Terasawa Y, Shibata H & Maki M (2005) Identification...