hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling Bin Zheng, Jin-kun Wen and Mei Han Department of Biochemistry and Molecular Biology, Hebei Medical University, Shijiazhuang, China Keywords actin-binding protein; cytoskeleton; F-actin; hhLIM; LIM domain Correspondence M Han, Department of Biochemistry and Molecular Biology, Hebei Medical University, No 361, Zhongshan East Road, Shijiazhuang 050017, China Fax: +86 311 8669 6826 Tel: +86 311 8626 5563 E-mail: hanmei@hebmu.edu.cn (Received 21 November 2007, revised 15 January 2008, accepted 30 January 2008) doi:10.1111/j.1742-4658.2008.06315.x Human heart LIM protein (hhLIM) is a newly cloned protein In vitro analyses showed that green fluorescent protein (GFP)-tagged hhLIM protein accumulated in the cytoplasm of C2C12 cells and colocalized with F-actin, indicating that hhLIM is an actin-binding protein in C2C12 cells Overexpression of hhLIM–GFP in C2C12 cells significantly stabilized actin filaments and delayed depolymerization of the actin cytoskeleton induced by cytochalasin B treatment Expression of hhLIM–GFP in C2C12 cells also induced significant changes in the organization of the actin cytoskeleton, specifically, fewer and thicker actin bundles than in control cells, suggesting that hhLIM functions as an actin-bundling protein This hypothesis was confirmed using low-speed co-sedimentation assays and direct observation of F-actin bundles that formed in vitro in the presence of hhLIM hhLIM has two LIM domains To identify the essential regions and sites for association, a series of truncated mutants was constructed which showed that LIM domain has the same activity as full-length hhLIM To further characterize the binding sites, the LIM domain was functionally destructed by replacing cysteine with serine in domain 2, and results showed that the second LIM domain plays a central role in bundling of F-actin Taken together, these data identify hhLIM as an actin-binding protein that increases actin cytoskeleton stability by promoting bundling of actin filaments The actin cytoskeleton is a highly organized and dynamic structure present in all eukaryotic cells, where it plays a central role in many processes including intracellular transport and cell growth, signaling, and division Many of the actin-binding proteins affect the cytoskeletal structure and architecture by mediating the association of actin filaments into cables and bundles and cross-linking these structures into complex networks [1] The data presented here demonstrate that human heart LIM protein (hhLIM) is an actin-binding protein that participates in remodeling of the actin cytoskeleton, possibly by promoting actin bundling The LIM domain [CX2CX16–23HX2CX2CX2CX16–21CX2(C ⁄ H ⁄ D), where X denotes any amino acid] is a cysteine-rich zinc-finger motif found in a large family of proteins and now recognized as a key component of the regulatory machinery of the cell [2–4] Recent studies have indicated that proteins containing LIM domains have diverse cellular roles as regulators of gene expression, cytoarchitecture, cell adhesion, cell motility and signal transduction [3,5] hhLIM, also named hLIM3 (GenBank AF121260), was cloned by three-element PCR-select cDNA subtraction from the embryo heart cDNA library [6] Using insulin-like growth factor-1 and endothelin-1 as controls, our previous studies have shown that: (a) expression of the hhLIM gene is tightly linked to cardiac and skeletal specification, (b) hhLIM plays an important role in cardiac hypertrophy, (c) hhLIM can shuttle between the nucleus and the cytoplasm and initiate Abbreviations CRP, cysteine-rich protein; GFP, green fluorescent protein; GST, glutathione S-transferase; hhLIM, human heart LIM protein; MLP, muscle LIM protein 1568 FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS B Zheng et al cardiac hypertrophy, and (d) hhLIM is a member of the group of cytosolic LIM proteins and interacts with skeletal a-actin in the cytoplasm However, little is known about the mechanism whereby hhLIM interacts with skeletal a-actin and regulates the organization and rearrangement of the actin cytoskeleton [7] hhLIM contains two LIM domains and is most homologus to the cysteine-rich protein (CRP) family, which comprises three members (CRP1, CRP2 and CRP3) hhLIM displayed nuclear, actin-associated, and nuclear plus actin-associated distributions similar to those of CRPs But the one-LIM motif Drosophila protein (DMLP1) displayed a diffuse cytosolic pattern in subset of cells [8] The LIM homeo-domain protein Apterous and Isl-1 almost exclusively accumulated in the nucleus [9] The nuclear functions of CRPs have been studied over the past two decades and it is now well established that this subset of LIM proteins are important regulators of cell differentiation and transcription By contrast, their actin cytoskeleton-related roles have remained obscure CRPs were first believed to interact with actin filaments in an indirect manner through the intermediation of actin-binding protein partners such as a-actinin or zyxin [10] However, in agreement with our data on hhLIM, it has been demonstrated that CRP1 and CRP2 have the ability to interact with actin filaments in a direct manner Importantly, CRP1 has been shown to induce actin filament bundling in vitro, as well as in transformed rat embryonic fibroblasts [11,12] Taken together, these data strongly suggest that CRPs and CRP-related LIM proteins participate in regulation of the actin cytoskeleton architecture [13] Understanding the mechanism of actin filament stabilization and bundling triggered by hhLIM and CRPs requires, in the first instance, identification of their actin-binding domains To date, none of the actin-binding domain sequences registered in databases is present in hhLIM or CRPs The goals of this study were to define the actin-binding properties of hhLIM and determine the precise actin-binding sites of hhLIM Our results show that hhLIM binds to filamentous (F) actin and the second LIM domain of hhLIM plays a central role in this interaction Results hhLIM interacts and colocalizes with F-actin in the cytoplasm of C2C12 cells Using confocal microscopy we have identified that hhLIM is colocalized with actin filaments [7] To further confirm this interaction, coimmunoprecipitation and a pull-down assay were performed C2C12 cells hhLIM binds to F-actin transfected with Myc-tagged hhLIM and GFP-tagged actin were incubated in 2% horse serum to induce differentiation Extracts were incubated with anti-Myc or anti-GFP Sepharose, and interacting proteins were analyzed by western blotting with antibody specific to actin or GFP antibody Figure 1A shows that actin was specifically immunoprecipitated together with hhLIM To demonstrate that endogenous hhLIM and actin can form a complex in vivo, actin was immunoprecipitated from C2C12 cell lysates and the immunoprecipitates were analyzed by western blot using anti-hhLIM Ig The data showed that actin was specifically immunoprecipitated together with endogenous hhLIM, whereas protein A–agarose did not precipitate hhLIM Lysates were immunoprecipitated with anti-hhLIM Ig and detected by anti-actin Ig, and results showed the same specific interaction between endogenous hhLIM and actin, which indicated that the interaction of these two proteins is not an artifact of hhLIM overexpression (Fig 1B) The glutathione S-transferase (GST) pull-down experiment also demonstrated a direct interaction between GST–hhLIM and actin GST or GST–hhLIM fusion proteins were bound to glutathione–Sepharose and incubated with purified rabbit skeletal muscle actin or lysates from hhLIMexpressing cells After extensive washing, Sepharose pellets were immunoblotted with anti-actin Ig to detect actin in fusion protein or the pellets with anti-GST Ig to demonstrate equal loading of fusion protein As shown in Fig 1C, both purified actin and endogenous actin bound to GST–hhLIM but not GST hhLIM bundles F-actin directly In order to identify whether hhLIM and actin interact directly, we investigated the activities of hhLIM binding to actin using a co-sedimentation assay Purified F-actin was incubated with recombinant hhLIM protein, and pelleted by centrifugation at 10 000 g, which allows pelleting of heavy, cross-linked F-actin only Controls for this series of experiments included SM22a, a known actin cross-linking protein, and BSA, which does not interact with or cross-link actin In the absence of hhLIM, the majority of actin remained in the supernatant (S) and only a small amount was detected in the pellets (P) The addition of hhLIM significantly enhanced the amount of actin present in the pellets (P) compared with samples with actin alone or with the BSA control (Fig 2A) These data indicated that hhLIM binds to and has a bundling effect on actin Figure 2B shows that, in the absence of hhLIM, 20% of the total actin was detected in the pellet By contrast, in the presence of hhLIM, the amount of FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS 1569 hhLIM binds to F-actin A B Zheng et al IP with Myc Ab GFP Myc pcDNA3-hhLIM + – + – pEGFP-actin – + + – B (a) IP with actin Ab – + (b) IP with hhLIM Ab hhLIM + Actin Actin – hhLIM Total lysates Total lysates Actin hhLIM C GST GST-hhLIM Actin GST Fig Actin interacts with hhLIM in C2C12 cells Coimmunoprecipitation of GFP-tagged actin with myc-tagged hhLIM Lysates of C2C12 cells transfected with full-length myc-tagged hhLIM and GFP-tagged actin was immunoprecipitated (IP) by anti-myc Ig coupled to Sepharose, and interacting proteins were separated by SDS ⁄ PAGE and blotted with anti-GFP or anti-myc Ig (B) (a) Cell lysates of C2C12 cells were immunoprecipitated with anti-actin Ig or protein A–agarose as indicated Immunoprecipitates and total lysates were analyzed by western blotting using anti-actin and antihhLIM Ig; (b) cell lysates were immunoprecipitated with anti-hhLIM Ig or protein A–agarose and detected using anti-hhLIM and antiactin Ig Whole-cell extracts of each group were harvested as a control to demonstrate proper expression of each protein These experiments were repeated three times (C) GST pull-down assay Purified recombinant GST (lane 1) or GST–hhLIM fusion protein (lanes 2–4) coupled to glutathione–Sepharose was incubated with rabbit muscle actin (lane 2) cell extracts from C2C12 cells transfected with hhLIM expression plasmids (lanes and 3) or transfected with pcDNA plasmid (lane 4) After extensive washing, Sepharose beads were analyzed by SDS ⁄ PAGE and immunoblotted using antiactin (upper) or anti-GST (lower) Ig 1, Extracts from C2C12 cells transfected with hhLIM expression plasmid; 2, rabbit muscle actin protein; 3, extracts from C2C12 cells transfected with hhLIM expression plasmid; 4, extracts from C2C12 cells transfected with pcDNA plasmid actin in the pellet increased along with the increment of the hhLIM, indicating that hhLIM induces F-actin bundling Maximum actin bundling occurred when 1570 molar ratios of hhLIM (2 lm) to actin (8 lm) were > : Indeed, when the concentration of hhLIM exceeded lm, 60% of total actin was detected in the pellet (Fig 2B) Cumulative data from several independent experiments demonstrated that the co-sediments of hhLIM and F-actin was greater than that of actin alone (Fig 2C) In order to directly analyze the effect of GST–hhLIM on actin filament bundling, we performed electron microscopy on negatively stained actin filaments As shown in Fig 2D, in the absence of hhLIM, actin filaments formed a uniform meshwork of fine filaments The inclusion of BSA had no effect on the ability to bundle actin, however, when actin was polymerized in the presence of hhLIM, higher order structures were observed Although single actin filaments were still present, most of the actin filaments were recruited into thick and long actin bundles, confirming the cross-linking activity of hhLIM To determine whether hhLIM also binds to monomeric (G)-actin, GST pull-down assays were performed with GST–hhLIM versus GST alone Although actin was pulled down with GST–hhLIM, there was no significant difference between samples containing GST– hhLIM and GST alone (Fig 2E) Thus, this approach suggests that hhLIM does not bind to monomeric actin hhLIM stabilizes F-actin in C2C12 cells To further determine whether hhLIM modulates the actin cytoskeleton in C2C12 cells, we studied the effects of hhLIM overexpression on the actin stress fibers Overexpression of hhLIM induced actin polymerization (data not shown) We have established that overexpression of hhLIM may increase the expression of actin [7] The actin fractionation assay showed that the F-actin fraction (csk) was increased compared with the G-actin fraction (sol) in cells overexpressing hhLIM Silencing of hhLIM expression by siRNA had the opposite result (Fig 3A) If the expression of GFP–hhLIM could increase actin filament bundling, then GFP–hhLIM would be expected to redistribute to the Triton X-100-insoluble cytoskeletal fraction As shown in Fig 3B, the insoluble hhLIM fraction increased with in a dose-related manner So, we predicted that hhLIM might participate in F-actin formation and stabilization of actin filaments In order to test whether hhLIM could affect the stability of the actin cytoskeleton following its ectopic expression in C2C12 cells, actin depolymerization was induced by cytochalasin B in hhLIM–GFP–transfected C2C12 cells The actin cytoskeleton was visualized by TRITC– phalloidin staining before adding cytochalasin B, and FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS B Zheng et al hhLIM binds to F-actin A * S Actin (8 µM) hhLIM Actin (8 µM) hhLIM P 0.25 0.5 D ac 1.6 1.2 0.8 0.4 16 µM [hhLIM] (b) (a) + SM LI hh C hhLIM bound to F-actin B tin tin P – + – + BS A S – + – + ac P – + + – + S – + + – 22 P – + – – tin S – + – – ac P + + – – + S + + – – M hhLIM Actin SM22α BSA * in SM22α ct hhLIM A Actin P/S ratio for actin BSA (c) 10 hhLIM (µM) 15 20 (d) GST GST-hhLIM E Actin GST Actin – + – + Fig Functional interaction between hhLIM and F-actin (A) Coomassie Brilliant Blue stained SDS ⁄ PAGE gel showing typical actin co-sedimentation assay hhLIM, SM22a or BSA were incubated with actin for 30 in F-actin buffer containing ATP and Ca2+ and then centrifuged at 10 000 g for 30 Proteins in the pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE Densitometry was performed to determine the actin P ⁄ S ratios of three independent experiments to quantify the effect of hhLIM on actin sedimentation *P < 0.05, compared with the control (B) Actin at lM alone or in the presence of different concentrations of hhLIM (0.25–16 lM) was polymerized and centrifuged Proteins in the pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue (C) Quantitation analysis for GST–hhLIM association with F-actin at different concentrations of GST–hhLIM The F-actin concentration was lM After SDS ⁄ PAGE and staining, gels were scanned and the amount of protein that was present in the pellet and supernatant was quantified The concentration of actin-bound hhLIM was plotted against the concentration of free hhLIM Values are means ± SEM for three independent experiments (D) Electron microscopy morphology of the filaments assembled from the GST–hhLIM-actin complex Electron microscopy of negatively stained actin filaments was performed with the following combinations of purified proteins: (a) lM actin and lM GST– hhLIM; (b) lM actin; (c) lM actin and lM SM22a; (d) lM actin and lM BSA Bar = 70 nm (E) In vitro binding analysis using nonomeric (G) actin and GST or GST–hhLIM bound to glutathione agarose beads Western blot of GST pull-down assay fractions using an actin antibody showing similar amounts of actin in samples with GST Sepharose versus GST-tagged hhLIM As expected, no signal was detected in the absence of G-actin Similar results were obtained in three independent experiments 10 and 30 after treatment (Fig 3C) As early as 10 after cytochalasin B application, partial depolymerization of the actin cytoskeleton occurred in nontransfected cells, whereas hhLIM-expressing cells showed an unaffected actin network (data not shown) After 30 of treatment, most of the nontransfected cells showed a fully depolymerized actin cytoskeleton By contrast, the morphology of hhLIM– GFP-expressing cells remained normal, indicating that the cytoskeleton was existent and supported the FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS 1571 hhLIM binds to F-actin B Zheng et al A Actin (sol) Actin (csk) hhLIM (sol) GAPDH (csk) Con hhLIM hhLIM (–) 10 pcDNA-hhLIM csk/sol B hhLIM Sol csk sol csk sol csk sol csk 34 56 pcDNA-hhLIM C (a) Cytochalasin B hhLIM (b) actin (c) Merged (d) actin (e) hhLIM (f) actin (g) Merged (h) actin (i) hhLIM (j) actin (k) Merged (l) actin Pholloidin Con D hhLIM (sol) hhLIM (csk) Actin (sol) Actin (csk) Con CB Phalloidin appearance of the cell (Fig 3C) Finally, 120 after cytochalasin B application, almost all the hhLIMexpressing cells presented a fully disrupted actin cytoskeleton (data not shown) In order to test this further, 1572 Fig hhLIM stabilizes F-actin in C2C12 cells Extracts from C2C12 cells transfected with pcDNA, pcDNA3–hhLIM or hhLIM siRNA expression plasmids were separated into cytosolic soluble (sol) and cytoskeletonassociated proteins (csk) Equal amounts were separated by SDS ⁄ PAGE and proteins in each fraction were detected by immunoblotting by using anti-actin or anti-hhLIM Ig (B) C2C12 cells transfected with 0.5, 1, or 1.5 lg of hhLIM expression plasmid were lysed, and cytosolic soluble (sol) and cytoskeleton-associated proteins (csk) were separated for analysis Left, a representative result from three independent experiments is shown Right, the density of specific band of csk ⁄ sol was scanned and quantified (C) hhLIM delayed the effect of cytochalasin B on C2C12 cells (a–c) C2C12 cells transfected with pEGFP–hhLIM were treated with cytochalasin B for 30 min; (d) C2C12 cells were treated with cytochalasin B for 30 min; (e–g) C2C12 cells transfected with pEGFP–hhLIM were treated with phalloidin for 30 min; (h) C2C12 cells were treated with phalloidin for 30 min; (i–k) C2C12 cells transfected with pEGFP– hhLIM; (l) C2C12 cells transfected with pEGFP (D) C2C12 cells were treated with cytochalasin B or phalloidin for 30 and lysed by lysis buffer and separated into cytosolic soluble (sol) and cytoskeletonassociated proteins (csk) Equal amount were separated by SDS ⁄ PAGE and proteins in each fraction were detected by immunoblotting by using anti-actin or anti-hhLIM Ig C2C12 cells were treated with cytochalasin B and phalloidin for 30 min, and the distribution of hhLIM and actin in the soluble (sol) and cytoskeleton (csk) fractions was determined by western blotting As shown in FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS B Zheng et al Fig 3D, cytochalasin B led to the release of hhLIM from the insoluble fractions This was consistent with the result of immunofluorescence analysis, indicating that hhLIM participates in actin polymerization (Fig 3C) However, pelletable hhLIM from phalloidin-treated C2C12 cells was increased by 100% Together, these results indicate that modulation of the actin cytoskeleton induces changes in hhLIM localization LIM domain of hhLIM mediates the interaction between hhLIM and actin hhLIM has two LIM domains To identify which domains or sites of hhLIM interact with actin, a series of truncated mutants was constructed and a GST pulldown assay was used This showed that the F4 region (amino acids 41–194), which contains the LIM domain 2, has almost the same activity as full-length hhLIM Interestingly, although the F5 region (amino acids 41–154), with the C-terminus of the F4 region deleted, is still able to interact with actin, binding activity is decreased compared with the F4 region By contrast, the F3 fragment (amino acids 1–120), with the C-terminus of hhLIM deleted, is not able to interact with actin The data suggest that hhLIM binding to actin requires a functional LIM domain (Fig 4A) To further characterize that LIM domain is sufficient to interact with actin, the LIM domain was functionally destroyed by replacing cysteine with serine in either domain (mLIM1) or (mLIM2), and an in vitro GST pull-down assay was used Figure 4B shows that F-actin was pulled down by full-length hhLIM and mutant mLIM1, indicating an interaction, whereas mLIM2 did not pellet with actin To further identify the LIM domain that mediates the interaction of hhLIM with actin, we transfected C2C12 cells with GFP-tagged full-length hhLIM or GFP-tagged LIM domain-mutated constructs and detected the distribution of hhLIM The results revealed that mLIM2 is mainly diffused and fuzzily distributed (Fig 4C) To characterize further the interaction between hhLIM mutants and actin, co-sedimentation assays were performed using purified actin and GST–mLIM1or GST– mLIM2 protein As shown in Fig 4D, full-length hhLIM and hhLIM mutants co-sedimented with F-actin, but the amount of sedimented actin is lower in the presence of mLIM2 than in the presence of mLIM1 or full-length hhLIM Importantly, mutation of LIM domain dramatically affected the contraction of the C2C12 cells compared with cells expressing hhLIM, which may underlie the dysfunction (Fig 4E) Taking these factors together, we determined that tar- hhLIM binds to F-actin geted disruption of the second LIM domain of hhLIM destroys the interaction between hhLIM and the contractive ability of C2C12 cells, indicating the important role that LIM domain plays in controlling assembly and organization of the actin cytoskeleton Discussion The plasticity of the actin cytoskeleton relies mainly on the ability of actin filaments to form, branch, bundle, and disassemble within short timeframes in response to many signals LIM proteins play a critical role in the organization of the actin cytoskeleton WLIM1 was found both to associate with the actin cytoskeleton in a very dynamic manner and to circulate rapidly throughout the cytoplasm, making it available wherever and whenever it was needed for new actin bundle formation [1,14] WLIM1 protein contains two LIM domains, deletion of one of the domains reduced significantly, but did not entirely abolish, the ability of WLIM1 to bind actin filaments Variants lacking the C-terminal or inter-LIM domain were only weakly affected in their F-actin stabilizing and bundling activities, and trigger the formation of thick cables containing tightly packed actin filaments as does the native protein By contrast, deletion of one of the two LIM domains negatively impacted both activities and resulted in the formation of thinner and wavier cables [13] Zyxin-related protein 1, which belongs to a family of LIM-containing proteins that includes zyxin and lipoma-preferred partner, participates in the organization of the actin cytoskeleton [15] FHL2 was observed, along with F-actin, to be involved in the focal adhesion of C2C12 and H9C2 myotubes [16] Overexpression of FHL2 promotes differentiation by binding to b-catenin [17] FHL3 regulates a-actinin-mediated actin bundling as an actinbinding protein [18] CRP3 (also called muscle LIM protein–MLP) plays an important role in myogenesis and in the promotion of myogenic differentiation This function has been related to its myofibrillar location in close vicinity to the Z disk and its interaction with a-actinin MLP is highly expressed during differentiation in all types of striated muscle, but its expression in the adult is restricted to cardiac and slow-twitch fibers of skeletal muscle [8,19] Moreover, it has been reported that targeted deletion of MLP in mice causes marked disruption of the myocardial cytoarchitecture, leading to dilated cardiomyopathy and death resulting from cardiac failure [10,20,21] Despite the dramatic consequences associated with loss of MLP expression, the mechanistic details of CRP function in muscles remain speculative The data presented here identify a FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS 1573 hhLIM binds to F-actin B Zheng et al member of the CRP family, hhLIM, as a new F-actinbinding protein whose targeting of actin filaments stabilizes the actin cytoskeleton and promotes actin bundle ⁄ cable formation We conclude that hhLIMs are real F-actin-binding protein on the following observations: (a) hhLIM colocalized with F-actin, (b) hhLIM showed F-actin-binding activity, and (c) hhLIM cosedimented with F-actin The interaction between hhLIM and actin filaments was previously believed to be indirect, requiring intermediary proteins such as a-actinin or zyxin However, it is clearly established that hhLIM and other members of the CRP family are autonomous F-actin-binding proteins Our in vitro investigations provide, for the first time, strong augments supporting the idea that the LIM domain participates in the F-actin binding and bundling activities displayed by hhLIM Confocal analyses showed that hhLIM accumulates in both the nucleus and the cytoplasm, where it predominantly associates with the actin cytoskeleton [7] This dual location is in agreement with that reported previously for members of the CRP family and other CRP-related proteins, such as MLP [22] Although CRPs were first believed to interact indirectly with the actin cytoskeleton via intermediary proteins, such as zyxin and a-actinin, recent studies have shown that CRP1 and CRP2 are autonomous actin-binding proteins [11,23] Our in vitro results extend this property to the hhLIM protein, suggesting that all CRPs and CRP-related proteins have the ability to associate with F-actin Here, we demonstrate the ability of a new LIM protein to interact with F-actin in a direct manner Formation of higher order actin structures, such as bundles and cables, is crucial to stabilize the organization of transvacuolar strands and maintain overall cellular architecture As mentioned above, CRP1 may participate in the formation and ⁄ or maintenance of long actin cables [12] Consistent with this hypothesis, we observed that ectopic expression of hhLIM in C2C12 cells stabilizes actin filaments ⁄ bundles against cytochalasin B In addition, overexpression of hhLIM in C2C12 cells induces an increase in the overall amounts of actin and F-actin This prompted us to investigate whether hhLIM stabilizes and bundles actin filaments directly In vitro cytochalasin B experiments demonstrated that hhLIM stabilizes F-actin by itself In addition, co-sedimentation assays and the direct observation of in vitro actin filaments that have been polymerized in the presence of hhLIM demonstrated that hhLIM bundles actin filaments in an autonomous manner hhLIM consists of two LIM domains Targeted disruption of the second LIM domain of hhLIM abolished F-actin-binding activity, indicating the important role that LIM domain plays in the control of assembly and organization of the actin cytoskeleton In conclusion, in vitro results show that hhLIM interacts with filamentous actin in a direct manner hhLIM enhances the stability of the actin cytoskeleton and promotes actin bundling Although the exact contribution made by hhLIM protein to actin cytoskeleton dynamics ⁄ remodeling remains to be explored, the data provide strong evidence that hhLIM is an actin cytoskeleton organizer An open question is the significance of hhLIM in the nucleus Several LIM proteins have been shown to shuttle between the cytoplasm and the nucleus and it has been suggested that they mediate communication between both compartments Similar functions for hhLIM proteins cannot be excluded Consistent with a nuclear role for hhLIM, it has been Fig Relationship between the structure and the activation activity of hhLIM (A) Requirement of the C-terminal half of hhLIM for association activity with actin hhLIM and its various derivatives were constructed into PGEX-3X plasmids GST–hhLIM and its derivative proteins are schematically depicted on the left Association activities of hhLIM and its derivatives are represented on the right Extracts from C2C12 cells were precleared with GST–Sepharose beads and then incubated with GST–hhLIM Sepharose beads or its derivative proteins Pellets were washed, and interacting proteins were separated by SDS ⁄ PAGE and identified by western blotting (B) Mutation of LIM domain of hhLIM disrupts the association with actin Extracts from C2C12 cells were precleared with GST–Sepharose beads and then incubated with GST–hhLIM Sepharose beads, or LIM domain-mutated (mLIM1, GST-mLIM110Cys fi Ser, 13Cys fi Ser, mLIM2, GST-mLIM2120Cys fi Ser, 123Cys fi Ser) Sepharose beads or GST–Sepharose beads Pellets were washed, and interacting proteins were separated by SDS ⁄ PAGE and identified by western blotting (C) Fluorescence analysis of hhLIM in the C2C12 cells C2C12 cells were transfected with pEGFP–hhLIM, pEGFP– mLIM1(10Cys fi Ser, 13Cys fi Ser), pEGFP-mLIM2(120Cys fi Ser, 123Cys fi Ser) or pEGFP The cells were fixed and examined with an IX71 fluorescence microscope (Olympus) (D) Actin co-sedimentation assay verified the functional interaction between hhLIM and F-actin Purified F-actin was incubated with GST–hhLIM or LIM domain-mutated hhLIM Cross-linked F-actin was pelleted by centrifugation, separated by SDS ⁄ PAGE, and stained with Coomassie Brilliant Blue (E) Densitometry micrograph was obtained of the agonist-induced contraction of C2C12 cells C2C12 cells were transfected with pEGFP (control), pEGFP–hhLIM, pEGFP–mLIM1(10Cys fi Ser, 13Cys fi Ser) or pEGFP– mLIM2(120Cys fi Ser, 123Cys fi Ser) and maintained in physiological rodent saline (138 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl2, 1.06 mM MgCl2, 12.4 mM HEPES, and 5.6 mM glucose, pH 7.3) in a chamber ( mL) mounted on the stage of an inverted microscope The C2C12 cell length was modified by acetylcholine stimulation (100 lM) *P < 0.05, compared with C2C12 cells transfected with pcDNA3–hhLIM plasmid 1574 FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS B Zheng et al hhLIM binds to F-actin reported to activate brain natriuretic factor (BNP) and atrial natriuretic factor (ANF) gene expression [7,24] Identification of further regulatory mechanisms that trigger the translocation of hhLIM between the cyto- A 10 31 41 plasm and the nucleus is an important goal for the future Perhaps the most fruitful area of future research in LIM biology will involve dissecting the precise roles of LIM proteins in both the nuclear and cytoplasmic 95 111 117 120 P P 154 160 194 P P Zinc finger C2H2 type domain LIM zinc-binding domain Protein kinase C phosphorylation site P F1 10 41 120 154 194 aa Actin F2 GST F3 F4 F1 F2 F3 F4 F5 Neg F5 LIM zinc-binding domain B Actin GST Neg mLIM1 LIM mLIM2 C pEGFP-hhLIM D pEGFP-mLIM1 pEGFP-mLIM2 pEGFP Actin mLIM1 mLIM2 hhLIM Actin SM222 S + – – + – P + – – + – S – + – + – P – + – + – S – – + + – P – – + + – S – – – + – P – – – + – S – – – + + P – – – + + cell contraction (um) E * hhLIM mLIM1 mLIM2 FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS 1575 hhLIM binds to F-actin B Zheng et al compartments, and deciphering how the role of a LIM protein that is associated with actin filaments might be integrated with nuclear functions and vice versa Experimental procedures Cell culture and transfection The C2C12 mouse myoblast line was maintained with Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum Differentiation was induced in C2C12 cells by replacing medium with Dulbecco’s modified Eagle’s medium containing 2% horse serum hhLIM expression plasmid was gift from KH Chen (National Institute on Aging, Baltimore, MD, USA) A hhLIM siRNA-expressing plasmid was constructed using BLOCK-iTÔ U6 RNAi Vector by subcloning double-stranded oligonucleotides complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs were performed with lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions Immunoprecipitation and western blotting C2C12 cells grown in Dulbecco’s modified Eagle’s medium, supplemented with 10% fetal bovine serum were transfected with cDNA constructs using Lipofectamine according to the manufacturer’s protocol Forty-eight hours later, cells were lysed in lysis buffer [20 mm Tris, pH 7.5, 150 mm NaCl, mm EGTA, mm EDTA, 1% Triton X-100, protease inhibitor mixture (Sigma, St Louis, MO, USA), and lm Na3VO4) Lysates were sonicated on ice, and cell debris was removed by centrifugation Lysates were precleared with protein A ⁄ G–agarose beads (Santa Cruz Biotechnologies, Santa Cruz, CA, USA), and the proteins were immunoprecipitated with the appropriate antibody overnight at °C followed by incubation with protein A ⁄ G–agarose for h at °C Immunoprecipitates were washed three times with lysis buffer, and proteins were separated on SDS ⁄ PAGE Immunoblotting analysis was performed as described previously [25–28] Primary antibodies used for the assays were anti-GST polyclonal Ig (1 : 500; Santa Cruz), anti-hhLIM polyclonal Ig (gift of KH Cheng, National Institute on Aging, Baltimore, MD), anti-GFP polyclonal Ig (1 : 500; Santa Cruz), and anti-(skeletal a-actin) polyclonal Ig (1 : 500; Santa Cruz) Site-directed mutagenesis of the LIM domain of hhLIM Site-directed mutation of each LIM domain was carried out by PCR using oligonucleotide primers that coded for the 1576 appropriate point substitutions of amino acids The reactions were carried out using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) Each mutation was verified by DNA sequence analysis PCR primers used in the site-directed mutagenesis of the LIM domain of hhLIM introduced two point mutations into each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢ Actin fractionation Cells were scraped, washed with NaCl ⁄ Pi, and lysed in buffer A (20 mm Tris ⁄ HCl, pH 7.5, 1% Triton X-100, mm EGTA, mm phenylmethylsulfonyl fluoride) on ice for 30 min, and then centrifuged at 12 000 g and °C for 30 The supernatants (sol) were harvested The pellets (csk) were lysed in buffer B (10 mm Tris ⁄ HCl, pH 7.5, 150 mm NaCl, 1% Triton X-100, 0.1% SDS, mm sodium deoxycholate, mm EGTA, mm phenylmethylsulfonyl fluoride) on ice for 30 min, and then centrifuged at 12 000 g for 30 The supernatants from the lysed pellets (csk) were harvested Protein concentration was determined by a modified Lowry protein assay Equal amounts of the supernatant (sol) and pellet (csk) were separated by 10% SDS ⁄ PAGE and stained with an antibody against hhLIM or actin, with visualization by secondary antibodies and enhanced chemiluminescence [29,30] Fluorescence staining Fluorescence staining was performed as described previously [12,31] The cells were stained for 20 with TRITC ⁄ phalloidin (1 lgỈmL)1) in blocking solution (1% BSA and 0.1% Triton X-100 in NaCl ⁄ Pi) in the dark at room temperature to localize F-actin GST pull-down assay In order to produce GST fusion proteins, full-length and domain-specific regions of hhLIM were generated in a pGEX-3X vector inframe with the N-terminal GST tag All new constructs were confirmed by restriction digestion followed by sequencing Protein expression was induced by reaction with 0.2 mm isopropyl thio-b-d-galactoside at 30 °C for h Bacterial lysates were purified over glutathione–agarose For the pull-down assay, cell lysate was prepared by lysing the C2C12 cells transiently transfected with myc-tagged different mutant or site-directed mutagenesis hhLIM that had been precleared with GST Sepharose beads Assay mixtures were then incubated with GST Sepharose beads or with hhLIM ⁄ GST Sepharose beads After centrifugation, the pellets were washed, and the FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS B Zheng et al interacting proteins were separated by SDS ⁄ PAGE and identified by western blot with an anti-actin Ig [32] Assay for low-speed co-sedimentation of hhLIM with F-actin G-Actin (Sigma) was polymerized by incubation at room temperature for 30 in a polymerization buffer (20 mm imidazole ⁄ Cl, pH 7.0, mm MgCl2, mm ATP, 0.5 mm dithiothreitol, 90 mm KCl) The lysates of the hhLIMexpressing cells were centrifuged at 10 000 g for 30 min, and the supernatant was used for the assay (F-actin) The supernatant of the lysates was incubated at room temperature for 30 with 0.3 mgỈmL)1 F-actin in a solution containing 25 mm imidazole ⁄ Cl, pH 7.0, mm MgCl2, mm ATP, 0.5 mm dithiothreitol, 27 mm KCl and 100 mm NaCl, and the mixture (50 lL) was placed over a 50 lL cushion of 30% sucrose in the polymerization buffer After the sample was centrifuged at 10 000 g for 20 min, the supernatant and the pellet were subjected to SDS ⁄ PAGE, followed by western blot analysis using the anti-hhLIM and anti-actin Ig [33–35] Electron microscopy Actin (8 lm) was polymerized at room temperature The actin mixtures were then diluted ⁄ with Mg-ATP buffer in the presence of purified GST–hhLIM (2 lm) alone or with BSA in a final reaction volume of 25 lL These mixtures were incubated for h at room temperature The protein mixtures were adsorbed onto carbon-coated 400-mesh grids for Actin filaments were negatively stained with 2% phosphotungstic acid, pH 7.4, for 15 s Grids were visualized using transmission electron microscopy (Hitachi Ltd., Saitama, Japan) at an accelerating voltage of 80 kV and a nominal magnification of ·100 000 [18] Measurement of contraction C2C12 cells were transfected with pcDNA3 (control), pcDNA3–hhLIM, pcDNA3–mLIM1(10Cys fi Ser, 13Cys fi Ser) or pcDNA3–mLIM2(120Cys fi Ser, 123Cys fi Ser) and maintained in physiological rodent saline (138 mm NaCl, 2.7 mm KCl, 1.8 mm CaCl2, 1.06 mm MgCl2, 12.4 mm Hepes, and 5.6 mm glucose, pH 7.3) in a chamber ( mL) mounted on the stage of an inverted microscope (Olympus, Tokyo, Japan) The C2C12 cell length was modified by acetylcholine stimulation (100 lm) for [25,36,37] Statistical analysis To control for day-to-day variations in staining intensity, untreated cells were always compared with treated cells on hhLIM binds to F-actin the same microscope slide because cells on the same slide undergo identical culture, fixation, permeabilization, staining and microscopy conditions, allowing meaningful comparisons between samples All data are presented as means ± SE Acknowledgements We thank Dr Da-zhi Wang (University of North Carolina) for helpful discussions and comments on the manuscript This work was supported by the Program for New Century Excellent Talents in University (No NCET-05-0261), a Key Project of the Chinese Ministry of Education (No.206016), the National Natural Science Foundation of the People’s Republic of China (No.30300132, 30570661) and the Major State Basic Research Development Program of China (No 2005CCA03100) References Thomas C, Hoffmann C, Dieterle M, Van Troys M, Ampe C & Steinmetz A (2006) Tobacco WLIM1 is a novel F-actin binding protein involved in actin cytoskeleton remodeling Plant Cell 18, 194–2206 Kadrmas JL & Beckerle MC (2004) The LIM domain: from the cytoskeleton to the nucleus Nat Rev Mol Cell Biol 5, 920–931 Zhi S, Yao A, Zubair I, Sugishita K, Ritter M, Li F, Hunter JJ, Chien KR & Barry WH (2001) Effects of deletion of muscle LIM protein on myocyte function Am J Physiol Heart Circ Physiol 280, H2665–H2673 Zheng B, Wen JK & Han M (2003) Factors involved in the cardiac hypertrophy Biochemistry Mosc 68, 650–657 Bach I (2000) The LIM domain: regulation by association Mech Dev 91, 5–17 Chen H, Zhou Z, Zhang JF & Zhou AR (2000) Screen heart-specific growth genes using three-element PCRselect cDNA subtraction Chin J Biochem Mol Biol 16, 295–300 Zheng B, Wen JK, Han M & Zhou AR (2004) hhLIM protein is involved in cardiac hypertrophy Biochim Biophys Acta 1690, 1–10 Arber S, Halder G & Caroni P (1994) Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation Cell 79, 221–231 Bourgouin C, Lundgren SE & Thomas IB (1992) Apterousis a Drosophila LIM domain gene required for the development of a subset of embryonic muscles Neuron 9, 549–561 10 Arber S & Caroni P (1996) Specificity of single LIM motifs in targeting and LIM ⁄ LIM interactions in situ Gene Dev 10, 289–300 FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS 1577 hhLIM binds to F-actin B Zheng et al 11 Grubinger M & Gimona M (2004) CRP2 is an autonomous actin-binding protein FEBS Lett 557, 88–92 12 Tran TC, Singleton CA, Fraley TS & Greenwood JA (2005) Cysteine-rich protein CRP1 regulates actin filament bundling BMC Cell Biol 6, 45–58 13 Thomas C, Moreau F, Dieterle M, Hoffmann C, Gatti S, Hofmann C, Troys MV, Ampe C & Steinmetz A (2007) The LIM domains of WLIM1 define a new class of actin bundling modules J Biol Chem 282, 33599–33608 14 Ketelaar T, Anthony RG & Hussey PJ (2004) Green fluorescent protein–mTalin causes defects in actin organization and cell expansion in Arabidopsis and inhibits actin depolymerizing factor’s actin depolymerizing activity in vitro Plant Physiol 136, 3990–3998 15 Sanz-Rodriguez F, Guerrero-Esteo M, Botella LM, Banville D, Vary CP & Bernabeu C (2004) Endoglin regulates cytoskeletal organization through binding to ZRP-1 a member of the Lim family of proteins J Biol Chem 279, 32858–32868 16 Li HY, Kotaka M, Kostin S, Lee SM, Kok LD, Chan KK, Tsui SK, Schaper J, Zimmermann R, Lee CY et al (2001) Translocation of a human focal adhesion LIM-only protein FHL2 during myofibrillogenesis and identification of LIM2 as the principal determinant of FHL2 focal adhesion localization Cell Motil Cytoskelet 48, 11–23 17 Martin B, Schneider R, Janetzky S, Waibler Z, Pandur P, Kuhl M, Behrens J, von der Mark K, Starzinski-Powitz A & Wixler V (2002) The LIM-only protein FHL2 interacts with b-catenin and promotes differentiation of mouse myoblasts J Cell Biol 159, 113–122 18 Coghill ID, Brown S, Cottle DL, McGrath MJ, Robinson PA, Nandurkar HH, Dyson JM & Mitchell CA (2003) FHL3 is an actin-binding protein that regulates a-actinin-mediated actin bundling J Biol Chem 278, 24139–24152 19 Schneider AG, Sultan KR & Pette D (1999) Muscle LIM protein: expressed in slow muscle and induced in fast muscle by enhanced contractile activity Am J Physiol Cell Physiol 276, C900–C906 20 Arber S, Hunter JJ, Ross JJ, Hongo M, Sansig G, Borg J, Perriard JC, Chien KR & Caroni P (1997) MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization dilated cardiomyopathy and heart failure Cell 88, 393–403 21 Flick MJ & Konieczny SF (2000) The muscle regulatory and structural protein MLP is a cytoskeletal binding partner of betaI-spectrin J Cell Sci 113, 1553–1564 22 Han M, Wen JK & Zheng B (2005) Roles of LIM proteins in cardiac hypertrophy Future Cardiol 1, 319–329 23 Pomies P, Louis HA & Beckerle MC (1997) CRP1 a LIM domain protein implicated in muscle differentiation interacts with alpha-actinin J Cell Biol 139, 157–168 24 Zheng B, Han M, Wen JK & Zhang R (2008) Human heart LIM protein activates atrial-natriuretic-factor 1578 25 26 27 28 29 30 31 32 33 34 35 36 37 gene expression by interacting with the cardiacrestricted transcription factor Nkx2.5 Biochem J 409, 683–690 Han M, Wen JK, Zheng B, Cheng Y & Zhang C (2006) Serum deprivation results in redifferentiation of human umbilical vascular smooth muscle cells Am J Physiol Cell Physiol 291, C50–C58 Zheng B, Wen JK & Han M (2006) hhLIM is involved in cardiomyogenesis of embryonic stem cells Biochem Mosc 71, S71–S76 Jiang GJ, Han M, Zheng B & Wen JK (2006) Hyperplasia suppressor gene associates with smooth muscle alpha-actin and is involved in the redifferentiation of vascular smooth muscle cells Heart Vessels 21, 315–320 Gorovoy M, Niu J, Bernard O, Profirovic J, Minshall R, Neamu R & Voyno-Yasenetskaya T (2005) LIM kinase coordinates microtubule stability and actin polymerization in human endothelial cells J Biol Chem 280, 26533–26542 Posern G, Sotiropoulos A & Treisman R (2002) Mutant actins demonstrate a role for unpolymerized actin in control of transcription by serum response factor Mol Biol Cell 13, 4167–4178 Ballestrem C, Wehrle-Haller B & Imhof BA (1998) Actin dynamics in living mammalian cells J Cell Sci 111, 1649–1658 Jiang GJ, Pan L, Huang XY, Han M, Wen JK & Sun FZ (2005) Expression of HSG is essential for mouse blastocyst formation Biochem Biophys Res Commun 335, 351–355 Akazawa H, Kudoh S, Mochizuki N, Takekoshi N, Takano H, Nagai T & Komuro I (2004) A novel LIM protein Cal promotes cardiac differentiation by association with CSX ⁄ NKX2-5 J Cell Biol 164, 395–405 Autieri MV, Kelemen SE & Wendt KW (2003) AIF-1 is an actin-polymerizing and Rac1-activating protein that promotes vascular smooth muscle cell migration Circ Res 92, 1107–1114 Chew CS, Chen XS, Parntte JA, Tarrer S, Okamoto C & Qin HY (2002) Lasp-1 binds to non-muscle F-actin in vitro and is localized within multiple sites of dynamic actin assembly in vivo J Cell Sci 115, 4787–4799 Cai L, Marhov AM & Bear JM (2007) F-actin binding is essential for coronin 1B function in vivo J Cell Sci 120, 1779–1790 Han P, Suizu T, Grounds MD & Bakkerl AJ (2003) Effect of indomethacin on force responses and sarcoplasmic reticulum function in skinned skeletal muscle fibers and cytosolic [Ca2+] in myotubes Am J Physiol Cell Physiol 285, C881–C890 Hopf FW, Reddy P, Hong J & Steinhardt RA (1996) A capacitative calcium current in cultured skeletal muscle cells is mediated by the calcium-specific leak channel and inhibited by dihydropyridine compounds J Biol Chem 271, 22358–22367 FEBS Journal 275 (2008) 1568–1578 ª 2008 The Authors Journal compilation ª 2008 FEBS ... differentiation by binding to b-catenin [17] FHL3 regulates a- actinin-mediated actin bundling as an actinbinding protein [18] CRP3 (also called muscle LIM protein? ??MLP) plays an important role in myogenesis... hhLIM Ab hhLIM + Actin Actin – hhLIM Total lysates Total lysates Actin hhLIM C GST GST -hhLIM Actin GST Fig Actin interacts with hhLIM in C2C12 cells Coimmunoprecipitation of GFP-tagged actin with... (D) Actin co-sedimentation assay verified the functional interaction between hhLIM and F -actin Purified F -actin was incubated with GST? ?hhLIM or LIM domain-mutated hhLIM Cross-linked F -actin was