0

for the amount of adjustments related to the unwinding of the discount with a credit to account 660

Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Cohen Type Inequality for Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product" potx

Hóa học - Dầu khí

... authors established the asymptotics of the zeros of such Jacobi-Sobolev polynomials The aim of our contribution is to obtain a lower bound for the norm of the partial sums of the Fourier expansion ... We call them the Jacobi-Sobolev orthogonal polynomials The measures μα,β and μα 1,β constitute a particular case of the so-called coherent pairs of measures studied in In see also , the authors ... in the norm of S∞ Acknowledgments The authors thank the careful revision of the paper by the referees Their remarks and suggestions have contributed to improve the presentation The work of the...
  • 22
  • 322
  • 0
Tài liệu Essential Skills for the Agile Developer: A Guide to Better Programming and Design pptx

Tài liệu Essential Skills for the Agile Developer: A Guide to Better Programming and Design pptx

Hệ điều hành

... work together to make software that is readable, scalable, maintainable, and elegant In addition to these individual authors and thought leaders, we also want to acknowledge the thousands of students ... don’t want to test them We want to be able to refactor them (even eliminate them) and have the same tests pass as before we refactored • We need to test them individually, as a practical matter ... processLargeTransaction(), and processSmallTransaction()) are not part of the API of the object but are simply the functional steps along the way They are often called “helper methods” as a result For...
  • 262
  • 1,467
  • 1
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học

... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... b-DG(654–750), and Asat and A0 are the absorbances at saturation and in the absence of ligand, respectively Data were normalized according to the equation (Ai ) A0 ) ⁄ (Asat ) A0 ) and reported as fractional...
  • 15
  • 337
  • 0
The German Implementing Act for the AIFM Directive: A Critical Survey of the Draft Bill ppt

The German Implementing Act for the AIFM Directive: A Critical Survey of the Draft Bill ppt

Quỹ đầu tư

... of the investors and the cash resources of the AIF or, where applicable, the AIFM working for the AIF, are being transferred properly to the relevant accounts opened in the name of the AIF, the ... in Kazakhstan are provided by the Almaty branch of Dechert Kazakhstan Limited A list of the names of the directors of Dechert Kazakhstan Limited is available for inspection at its registered office: ... expansion of the GITA to the future area of application of the draft of the GIC appears unlikely because (for InvestmentKGs) this would interfere with the general income tax principles for taxation of...
  • 13
  • 514
  • 0
Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt

Báo cáo khoa học

... myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-AlaAla-Ala-Ala (Myr–AGG1-3X6S), with position of each motif separately occupied by each of ... N-myristoylation (A) Structure of mature AGG1 fused at its N-terminus to the myristoylation motifs Met-Gly-Xaa-Ala-Ala-Ala-Lys-Ala-AlaAla (Myr–AGG1-3X 6A7 K) or Met-Gly-Xaa-AlaAla-Ser-Lys-Ala-Ala-Ala ... (Toyobo), yielding pTA2–AGG1 The coding region for mature AGG1 fused with a DNA fragment encoding the myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-AlaAla-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala...
  • 12
  • 473
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Phase I clinical trial of the vaccination for the patients with metastatic melanoma using gp100derived epitope peptide " pot

Hóa học - Dầu khí

... responses against the melanoma Thus the further development of this agent to be used as an immunogenic antigen in vaccine related therapies against melanoma is warranted Abbreviations ALT: alanine aminotransferase; ... Kimura A, Kato H, Sasazuki T: DNA typing of the HLA -A gene: population study and identification of for new alleles in Japan Tissue Antigens 1996, 47:93-101 24 Imanishi T, Akaza T, Kimura A, Tokunaga ... before each vaccination and weeks after the last vaccination for the immunological monitoring Drawn blood was heparinized, prepared for PBMCs with Ficoll-Paque (Amersham Biosciences, Piscataway,...
  • 12
  • 396
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

Hóa học - Dầu khí

... angle of the scapula (origin of the musculus levator scapulae) and on the lateral upper margin of the scapula for the m trapezius The tests for compression and traction of the neck are used to ... the other A soft end point or lack of a stop at the end of the range of movement ("drawer") is evidence of a lesion of the cruciate ligament [22] For reasons of practicability, occupational medicine ... system takes into account the fact that occupational medical prophylaxis does not aim primarily at producing a therapeutic indication but at prevention From the large number of available validated...
  • 10
  • 575
  • 0
báo cáo hóa học:

báo cáo hóa học:" Validation of the Individualised Neuromuscular Quality Of Life for the USA with comparison of the impact of muscle disease on those living in USA versus UK" doc

Hóa học - Dầu khí

... myotonias and inflammatory myopathies Quantitative data The percentage of UK and US patients scoring some impact (i.e scoring to for extent of impact), or no impact (scoring 1) for each of the ... MD These included a) planning; “Because of the condition it is not easy to things on the spur of the moment It is not always practical to go to places that are new to me without a bit of forward ... is made up of a variety of individual diseases each of which may each be rare It is reasonable to study them collectively as all MD may have common symptoms of weakness, fatigue, or pain and...
  • 38
  • 391
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Báo cáo khoa học

... cases of fusion with extra data situations lead to relatively better performance Therefore, the main emphasis is given to this monoradar case, leaving the definition of performance for other cases ... the accuracy and quality of available data, while target conditions are the distance and orientation of the flight with respect to radar, motion state of aircraft (uniform velocity, turning, accelerating), ... process to adjust the filter parameters according to ARTAS specifications are presented and analyzed They have been obtained particularizing expression (6) to the case of a weight of for all magnitudes...
  • 14
  • 342
  • 0
Báo cáo tin học:

Báo cáo tin học: "The maximum piercing number for some classes of convex sets with the (4, 3)-property" ppsx

Báo cáo khoa học

... 2, with endpoints b, c and central angle π Similarly arcs Ab and Ac are defined In other words, the points a, b, c and the arcs Aa , Ab , Ac form the vertices and edges of a Reuleaux triangle of ... that Da and Db have a non-empty intersection Let ua and va be the intersections of the boundary of Da with the semicircle Sb , such that ua is higher than va Similarly we define ub and vb as the ... than va and ub higher than a , the regions Da and Db would be disjoint (they would be separated by the line va a , for example) Since there is a point ca ∈ Db on the upper boundary of Da , either...
  • 16
  • 304
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Variation in the phenology of shoot elongation between geographic provenances of maritime pine (Pinus pinaster) - implications for the synchrony with the phenology of the twisting rust fungus" potx

Báo cáo khoa học

... 1992) as The cummulative degree-day values were always calculated from January of each year Statistical analysis Calendar days and the different heat sums, obtained with the aforementioned formula, ... distribution of intra-group variances Infection percentages were analysed using a generalization of the analysis of variance adapted to categorical data analysis (CATMOD procedure of SAS) A log-linear ... coefficients of variation (CV), ie the ratio of the mean to the standard deviation of these values, were then calculated The approach using the standard error of prediction is based on the comparison...
  • 16
  • 417
  • 0
báo cáo khoa học:

báo cáo khoa học: "Analysis of the recurrence risk factors for the patients with hepatocellular carcinoma meeting University of California San Francisco criteria after curative hepatectomy" pot

Báo cáo khoa học

... transplantation for hepatocellular carcinoma in cirrhotic patients: a critical factor American Journal of Transplantation 2010, 10:129-137 20 Sakata J, Shirai Y, Wakai T, Kaneko K, Nagahashi M, Hatakeyama ... Ichida T, Makuuchi M, Matsuyama Y, Nakanuma Y, Okita K, Omata M, Takayasu K, Yamaoka Y: Reevaluation of prognostic factors for survival after liver resection in patients with hepatocellular carcinoma ... Wakai T, Shirai Y, Yokoyama N, Nagakura S, Hatakeyama K: Hepatitis viral status affects the pattern of intrahepatic recurrence after resection for hepatocellular carcinoma European Journal of...
  • 6
  • 337
  • 0
A biophysical elucidation for less toxicity of Agglutinin than Abrin-a from the Seeds of Abrus Precatorius in consequence of crystal structure pot

A biophysical elucidation for less toxicity of Agglutinin than Abrin-a from the Seeds of Abrus Precatorius in consequence of crystal structure pot

Báo cáo khoa học

... http://www.jbiomedsci.com/content/17/1/34 Page of 13 Figure Comparison of AAG with abrin -a (green) molecule The α-carbon backbone of abrin -a AB-chains are superimposed on that of the AAG molecule using least-squares analysis A P41212 ... comparison of abrin -a (red) and γ3 respectively Active site residues are drawn in red (b) Active Site comparison of abrin -a (red) AAG A- chain (black) AAG A- chain (black) and AAG C-chain (blue) These ... programs They also thank to the National Science Council of Taiwan for financial support They are indebted to SPring-8 and the National Synchrotron Radiation Research Center for data collection Author...
  • 13
  • 259
  • 0
báo cáo khoa học:

báo cáo khoa học:" Validation of the Individualised Neuromuscular Quality Of Life for the USA with comparison of the impact of muscle disease on those living in USA versus UK" doc

Báo cáo khoa học

... of the residuals was examined to test for local independence The variance explained by the Rasch measures for the empirical calculation should be comparable to that of the model (>50% for an acceptable ... scale Although the raw variance explained by the PCA of the residuals was adequate (64.2%), the unexplained variance in the first contrast of the residuals was 3.9, suggesting the existence of a ... data available, respondents and non-respondents seemed no different However, too limited data was available for non-responders to allow for a statistical comparison Ethical approval was obtained...
  • 22
  • 484
  • 0
báo cáo khoa học:

báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

Báo cáo khoa học

... used to improve load-bearing capacity for implants, whereas the use of vertical alveolar grafting for augmentation without implant Orthoalveolar form is the concept for optimal restauration of the ... endosseous Camlog® implants were accurately positioned in the mandible and the maxilla according to the predefined planning that was made up of DVT scan and a wax up Again bone augmentation around the ... criteria for restauration of the edentulous maxilla and mandible are adequate bone mass and ortholalveolar form [6] This can be achieved by augmentation of the available substrate using established techniques...
  • 7
  • 375
  • 0
Franklin Road Academy Prepares for the Future With ADC’s CopperTen® 10-Gigabit Cabling

Franklin Road Academy Prepares for the Future With ADC’s CopperTen® 10-Gigabit Cabling

Phần cứng

... 20 years Head of School Dr Margaret (Sissy) Wade charged Compton and other FRA IT staff with the task of technology planning and project management for the new cabling system Compton’s team designed ... renovation of the upper school building that houses humanities and social studies, and the south campus that houses foreign language classrooms At the same time, planning began for a new state -of -the- art ... the overall size of FRA to more than 330,000 square feet of learning space “Our ultimate goal is to be able to broadcast using video over IP from any space on campus For example, if we want the...
  • 4
  • 336
  • 0
Sexuality for the Man With Cancer doc

Sexuality for the Man With Cancer doc

Sức khỏe giới tính

... Colostomy: A Guide (also available in Spanish) Ileostomy: A Guide Urostomy: A Guide Laryngeal and Hypopharyngeal Cancer (also available in Spanish) Nasal Cavity and Paranasal Sinuses Cancer Oral ... you may need a “loan” from one of the others to balance your account Try to be aware of the costs of cancer in your life Make a special effort to get new deposits for the accounts that remain active ... Cavity and Oropharyngeal Cancer Salivary Gland Cancer (also available in Spanish) Sarcoma – Adult Soft Tissue Cancer (also available in Spanish) Books The following books are available from the...
  • 56
  • 413
  • 0
IT Audit for the Virtual Environment: A SANS Whitepaper – September 2009 docx

IT Audit for the Virtual Environment: A SANS Whitepaper – September 2009 docx

Kế toán - Kiểm toán

... regulatory framework This ambiguity means that the easiest approach for auditors is to take the word “separate” to mean “separate hardware,” and simply insist on separate servers or a separate ... audits are actually assessing the same controls in the same way More important, collecting audit information manually forces auditors to create and format their audit from scratch, often manually ... Channel data is almost always transported in clear text Because of this, Fibre Channel architectures are susceptible to attacks of several types that are analogous to attacks in the physical Ethernet...
  • 13
  • 471
  • 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot

Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot

Cao đẳng - Đại học

... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... Adams and Abigail Adams and Charles Francis Adam 40 I have enjoyed as good health as usual, and much more than I know how to account for, when I consider the extreme heat of the weather and the ... absolutely necessary to the maintenance of the fabric of society Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Perhaps the preceding detail belongs...
  • 269
  • 350
  • 0

Xem thêm