estimation of intrinsically disordered protein shape and time averaged apparent hydration in native conditions by a combin
Báo cáo y học: "Insights into the regulation of intrinsically disordered proteins in the human proteome by analyzing sequence and gene expression data" potx
... Ensembl protein identifiers of our dataset of human proteins This gave a dataset of 3,839 proteins, each of which has an associated experimentally determined mRNA decay rate We separated our 3,839 protein ... Protein disorder, mRNA decay rates and protein stability indices We examined trends between mRNA decay rates and amounts of disordered residues, and between protein halflives and frequency of disordered ... back-propagation network trained to recognize features of ubiquitin targeting signals over a sliding window of 21 amino acids in the target sequence The network was trained using a balanced dataset of...
- 18
- 326
- 0
Physics of the Impossible: A Scientific Exploration into the World of Phasers, Force Fields, Teleportation, and Time Travel
... since each carbon nanotube is atomic in size, but the carbon nanotube lattice would be stronger than any ordinary material So, via a combination of plasma window, laser curtain, and carbon nanotube ... instincts but no formal training whatsoever, Maxwell, a contemporary of Faraday, was a master of advanced mathematics He excelled as a student of mathematical physics at Cambridge, where Isaac ... further in the next chapter And behind this laser curtain one might envision a lattice made of "carbon nanotubes," tiny tubes made of individual carbon atoms that are one atom thick and that are many...
- 353
- 550
- 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
... Roskams, T & Brechot, C (1999) Hepatocarcinoma-intestine-pancreas/pancreatic associated protein (HIP/PAP) is expressed and secreted by proliferating ductules as well as by hepatocarcinoma and ... colocalization of HIP/PAP with RIIa Staining was analyzed by confocal laser scanning microscopy Image is an optical section of 0.3 lm along the z-axis PKA activity in Chang cells expressing HIP/PAP ... HIP/PAP is a substrate for PKA (A) Recombinant HIP/PAP was incubated for 30 at 30 °C with the catalytic subunit of PKA and 100 lM [32P]ATP[cP] in 80 lL as described in the Materials and methods Aliquots...
- 9
- 310
- 0
Báo cáo hóa học: " Research Article Joint Estimation of Mutual Coupling, Element Factor, and Phase Center in Antenna Arrays" pdf
... arbitrary shapes that can match the true pattern of the measured antenna array This can increase the accuracy in the estimate of C compared to only assuming an omnidirectional element factor that ... as a jointly unknown parameter during the estimation of the coupling matrix, C This requires a parametrization that provides a flexible and mathematically appealing representation of an a priori ... element is DATA MODEL AND PROBLEM FORMULATION Consider a uniform linear antenna array with M elements having an interelement spacing of d A narrowband signal, s(t), is emitted by a point source...
- 9
- 293
- 0
Báo cáo khoa học: "Effects of Protein Source and Energy Substrates on the In Vitro Development of Bovine Embryos in a Two-step Culture System" ppsx
... non-essential amino acids stimulated blastocyst formation According to Liu and Foote [14] nonessential amino acids (NEAA) have a stimulatory effect upon all developmental stages, and essential amino acids ... Lee, E S and Fukui Y Synergistic effect of alanine and glycine on bovine embryos cultured in a chemically defined medium and amino acid uptake by in vitro produced bovine morulae and blastocysts ... in 2-3 ㎕ of medium, and 15 ㎕ of Hoechst 33342 stain prepared with sodium citrate (2.3%) and ethyl alcohol was added The slide was then incubated on a warming plate for min, the extra stain was...
- 6
- 514
- 0
Báo cáo khoa học: "Estimation of clonal contribution to cone and seed crops in a Sitka spruce seed orchard" potx
... Barker JE(1982) Effect of pollination period and strobili number on random mating in a clonal seed orchard of Picea mariana Silvae Genet 31, 90-94 Reynolds S, El-Kassaby YA (1990) Parental balance ... elevations between and 415 m on western Vancouver Island, Washington and Oregon The orchard was established in 1971 in a random single-tree mix over unequal blocks Trees are spaced m apart and ... and El-Kassaby (1990) used cumulative seedcrop data to assess parental balance in a Douglas fir seed orchard, and found the cumulative seed-yield curve is a better parameter than cone-yield in...
- 7
- 346
- 0
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... The amount of sGAG remaining within the cartilage explant after 24 hours of treatment with TNF-α and C2-ceramide in the presence and absence of 2-AP was determined by papain digestion and DMMB assay ... penicillin and 10 µg/ml streptomycin In vitro cartilage samples Cartilage was taken from the metacarpophalangeal joint of 7-day-old bovine calves within 12 hours of slaughter using a scalpel and...
- 10
- 379
- 0
Báo cáo y học: "Decreased levels of soluble amyloid β-protein precursor and β-amyloid protein in cerebrospinal fluid of patients with systemic lupus erythematosus" ppsx
... concentration of APP in samples of CSF was calculated from the linear part of a standard curve In contrast to other analyses, only 86 SLE patients were analyzed regarding APP A sandwich ELISA (Amersham ... All these biochemical indices are indirect measures of brain inflammation In contrast to a multitude of studies analyzing local inflammatory response in NPSLE, the evaluation of neuronal damage ... mechanisms of neuropsychiatric manifestations are still the subject of intense investigations, but autoantibody and cytokine-mediated neural dysfunction, intracranial angiopathy and coagulopathy have all...
- 8
- 342
- 0
Báo cáo khoa học: "The use of caspase inhibitors in pulsed-field gel electrophoresis may improve the estimation of radiation-induced DNA repair and apoptosis" pdf
... demonstrate that apoptosis induced by agarose is a component of total DNA breakage, and that the inhibition of apoptosis allows for more proper estimation of radiation-induced DNA DSB repair and apoptosis ... caspase-3 activation in irradiated cells growing as a monolayer, and caspase-3 activation was seen only in cells embedded in agarose (whether irradiated or not), allows us to rule out a radiation-induced ... apoptosis after 45 Gy (of 174 cells evaluated, were caspase positive after hours of incubation time: 3.44% of cell population), a finding that also precludes a substantial radiationinduced origin of apoptosis...
- 8
- 469
- 0
Báo cáo y học: "Estimation of lung vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry" pps
... Brazil 2Instituto Coração Hospital das Clínicas da Faculdade de Medicina da USP (InCor HC-FMUSP), São Paulo, Brazil 3Hospital Ana Neri da Faculdade de Medicina da Universidade Federal da Bahia ... the use of alternative ways to access VC in clinical practice [30] Table Comparison with averages and Standard deviation variables: age, BMI, DVC through ventilometry and spirometry in pre and post ... pre operatory groups a great value for clinical practice, mainly when these techniques can be applied in a practical way, in bed and at low cost In literature there is an array of researches highlighting...
- 5
- 342
- 0
Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps
... located in villages Nanakpur, Marranwala and Bassolan of Tehsil Kalka, District Panchkula in Haryana state of North India for allowing data collection Thanks are also due to the subjects who have ... Marranwala and Bassolan The participants were taken from a mixed population of the area i.e belonging to caste groups Lobana, Saini, Gujjar, Kumhar, Teli, Nai, Dhiman and Lohar These are the major ... accurate estimation of stature by linear regression analysis Although the SEE value is minimal and the predictive accuracy (R2) maximum for T1, accuracy of all measurements in stature estimation...
- 33
- 480
- 0
báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt
... 5'GGGCATTTTGGGTTATGT TG3' 5'TCCCCACTCGTTGTCATA CC3' 146 bp 5'CAGCAAGGGAGGAACCAG TA3' 5'TAGCGCAAGACCATCAAC AA3' 130 bp 5'ATGAAGGCGATGAAGGAG AA3' 5'GTACGCAATGGAATGGAA CC3' 112 bp 5'GGTCTTGCTCTCCATCTG CT3' ... 5'CGGGCTGTCGTCTCATAC TT3' 114 bp 5'ACCAGCACAAATCAAAGG A3 ' 5'GCCAAAGTATGAGACGAC AGC3' 149 bp 5'GTCACTAAGCCATCGGTC GT3' 5'ACACGGACACAACCAGTT CA3' 112 bp 0.94 0.020 GE617482 *Amplification efficiency was calculated ... Brazil are B brizantha cv Marandu and B decumbens cv Basilisk [1] They show qualities of forage grass, good adaptability to cerrado areas (dry-tropical savanna, Brazil), and are cultivated in...
- 10
- 267
- 0
Báo cáo y học: "Levels of anti-citrullinated protein antibodies and IgM rheumatoid factor are not associated with outcome in early arthritis patients: a cohort study" ppt
... committee and all patients gave written informed consent to be included in the study For the present analysis, all patients with available ACPA and IgM-RF data at baseline and after one year, and available ... correlation was Table 1: The relation between ACPA status and levels and outcome variables Correlation of ACPA levels at baseline P1 ACPA positive at baseline (n = 304) ACPA negative at baseline ... IgM-RF and ACPA compared with the absolute change of DAS28, HAQ and SHS The x-axes of a, c and f represent change in anti-citrullinated protein antibody (ACPA) levels in the first year The x-axes of...
- 7
- 357
- 1
Báo cáo y học: " Mitogen-activated protein kinases and NFκB are involved in SP-A-enhanced responses of macrophages to " pdf
... members of the STAT pathway, PI3K/Akt pathway and mitogen-activated protein (MAP) kinase family [10-12] MAP kinases are a family of serine/threonine kinases that are activated by phosphorylation of ... these pathways are activated by BCG alone and that opsonization of BCG with SP -A leads to enhanced activation of both pathways, contributing to increased intracellular BCG killing Materials and ... production induced by BCG and SP -A- BCG complexes Activation of intracellular protein tyrosine kinases is a common pathway involved in signalling induced by a variety of pathogens and pathogen-derived...
- 11
- 435
- 0
Báo cáo sinh học: "Genetic parameters for lactation traits of milking ewes: protein content and composition, fat, somatic cells and individual laboratory cheese yield" ppt
... the least amount of milk which was also the least rich in fat, protein, casein and serum protein contents As the ewes became older, there was an increase in fat and protein contents and the milk ... regard, both traits had a genetic correlation near unity and very close heritability and repeatability values and were equally correlated to LILCY, indicating that protein and casein contents are ... mean of somatic cells (in their natural logarithmic form) variance explained by the FYS factor was calculated by dividing the variance component of the FYS factor by the sum of the residual and...
- 16
- 316
- 0
IDENTIFICATION OF INTRINSICALLY DISORDERED SEPTAL PORE ASSOCIATED PROTEINS REGULATING DIVERSE ASPECTS OF
... can also be observed in amoebae (Allen and Allen, 1978b), algae and terrestrial plants (Allen and Allen, 197 8a) , and animals (Niwayama et al., 2011) In plants and animals, cytoplasmic streaming ... pores degenerate over time resulting in catastrophic hyphal failure, indicating that SPA13 plays a role in maintaining septal pore integrity In summary, using a machine learning approach together ... generated by actin and myosin and plays an important role in metabolism and development For instance, streaming in the one cell embryo of C elegans is involved in the partitioning of PAR proteins...
- 0
- 115
- 0
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.
... people at home not have a full breakfast according to traditional breakfast as well as conditional breakfast They often have cereal or porridge, egg and bacon followed by toast and marmalade and coffee ... drink a glass of mild and a sandwich 3.1.6 Parts of meal Basically, English meals and meal time are quite clear Even name of courses are also: starter, main course/ meat course and dessert Actually, ... the market Market-goers can squat, sit on a bench or eat and walk or eat and stand at the same time 4.2.4 Pubs and bars Generally speaking, pubs and bars are new types of eating have come into...
- 54
- 1,037
- 1
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt
... GAGTTATCAACGACGAGTGTCC GAGACGACAAGGCTCAGTCC AAAGGTTTCCTCCACCCTGT ACTTCCTCGAGCTTGTCACG GACTTGGAGCACGTGTGT TATTGGTCAAACTCGTCCAT AAGACAGGAATGGCGAGT AATCTCTCAGCTCTTCGGGAC AAACGGTCACCCTCCTTGA ACTTCCTCGAGCTTGTCACG Product ... traps in the Menai Strait, UK, and maintained in a recirculating seawater system under ambient conditions MIH and CHH were purified from sinus gland extracts by HPLC and quantified by amino acid ... 30 Kotlyar, S., Weirauch, D., Paulsen, R.S & Towle, D.W (2000) Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus...
- 9
- 587
- 0
Báo cáo khoa học: NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ1) and calcium and integrin binding protein (CIB) and shows developmentally restricted expression in the neural tube pptx
... full-length cDNA of the calcium and integrin binding protein (CIB) in frame with the GAL4 AD Mapping of regions involved in the interaction show that CIB and FEZ1 bind in the same domain of NBR1 To ... protein and a phosphotyrosine-independent ligand of the p56lck SH2 domain share a common domain composition and organization, consisting of an octicosapeptide repeat domain, a ZZ zinc ®nger and a ... coiled-coil and (UBA) ubiquitin-associated domain The amino acids encoding each domain are shown below and the ®gure is not drawn to scale (B) Yeast two-hybrid assay analysis identi®es CIB and FEZ1 as interacting...
- 8
- 421
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25