es amp g concerns as key requirements and determinants of long term business success
when genius failed the rise and fall of long term capital management roger lowenstein
... country might be oddly out of line for a certain duration of debt For instance, medium -term rates might be far higher than short -term rates and almost as high as long- term rates Long- Term would ... of winning business from the fund.18 It invested $65 million Long- Term also snared Banco Garantia, Brazil’s biggest investment bank In the United States, Long- Term got money from a diverse group ... mortgages in 1993 were not so eager to it again Long- Term made several hundred million dollars It was off to a sizzling start Despite appearances, finding these “nickels” was anything but easy Long- Term...
- 190
- 716
- 1
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC GCCAGCCCCCTGATGGGGGCGA ... CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT ... TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG...
- 15
- 597
- 0
Chapter 12: Charging Methods and Techniques: General Requirements and Selection of Chargers pdf
... Charging currents of twice or three times I5 are not of interest as the gassing voltage is attained too fast and forces lowering of the charging current, and apart from that makes the chargers more expensive ... COMPARING CHARGING METHODS FOR LEAD BATTERIES Table 12.6 compares some charging methods for lead batteries Table 12.5 Charging data for gas-tight NiCd batteries Type of charge Standard charge Accelerated ... for charging traction batteries, whereas IU-type charging is conducted in large battery stations for parallel charging of several batteries at a time For fast charging of batteries (in pauses, for...
- 25
- 356
- 1
Tài liệu Handbook of Long-Term Care Administration and Policy pdf
... description of the roles of other team members as well She begins by describing the types of LTC housing and related services, detailing the medical and residential models of care and addressing the ... Administration program and the developer and coordinator of the Graduate Certificate Program in Long- Term Care Administration and Policy She serves as adjunct Associate Professor of Management and Health ... research focuses on assisting state government in planning for Medicaid-funded long- term care services and expenditures as the demands on these public programs continue to expand Other studies...
- 466
- 357
- 1
Assuring Access in Key Strategic Regions - Toward a Long-Term Strategy docx
... xviii Assuring Access in Key Strategic Regions: Toward a Long- Term Strategy Toward an Access Strategy These results, coupled with the earlier efforts on the access game begun in the early phases of ... role of land forces and on campaign outcomes and measures of effectiveness • Most adversaries presently lack strategic reach except through special operations forces or terrorist proxies and therefore ... part of the RAND Corporation monograph series RAND monographs present major research findings that address the challenges facing the public and private sectors All RAND monographs undergo rigorous...
- 187
- 251
- 0
TRENDS AND DETERMINANTS OF MANAGING VIRTUAL R&D TEAMS ppt
... Management of Engineering and Technology (PICMET) References Albers, S and Eggers, S (1991) Organisatorische Gestaltungen von Produktinnovations-Prozessen Fuhrt der Wechsel des Organisationsgrades ... virtual and open organizations (Gassmann, 2001), and new ways of incentive systems and operating modes have emerged in these user and hacker communities Software engineers and programmers are highly ... information and communication technologies, growing experience with managing transnational R&D processes, and the globalization of technology are championing a new standard in international R&D organization...
- 20
- 484
- 0
OECD Health Policy Studies Help Wanted - Providing And Paying For Long-Term Care potx
... and fair long- term care policies is only going to get bigger and bigger, as populations age Learning from other countries’ experiences, both good and bad, might save much money and grief This ... FOR LONG- TERM CARE © OECD 2011 GLOSSARY Glossary Activities of daily living (ADL): include bathing, dressing, eating, getting in and out of bed or chair, moving around and using the bathroom Often ... of growing need for long- term care? Chapters and examine the growing demand for long- term care in the context of ageing societies, discuss demographic projections and their implications for long- term...
- 327
- 514
- 0
Báo cáo khoa học: Transducer of regulated CREB and late phase long-term synaptic potentiation pptx
... Talents Plan’ of the Chinese Academy of Sciences and Shanghai Pujiang Program Grant (05PJ14114) References Whitlock JR, Heynen AJ, Shuler MG & Bear MF (2006) Learning induces long- term potentiation ... interesting question is what types of kinase and ⁄ or phosphatase are responsible for this shuttling process of TORC1 in neurons In cell line, salt inducible kinase (SIK) and protein phosphatase ... Basic Research Program of China Grant (2006CB806600), the Key State Research Program of China Grant (2006CB943900), national ‘863’ high-tech research and development program (2006AA02Z166), and...
- 6
- 379
- 0
báo cáo hóa học: " Identifying type and determinants of missing items in quality of life questionnaires: Application to the SF-36 French version of the 2003 Decennial Health Survey" pot
... Age, Depression, Number of missing data for other items, SF score GH2 Get sick easier 6.4% Age, Number of missing data for other items, GH and SF scores MNAR GH3 As healthy as anybody 6.0% Age, Hospitalization, ... between 2% and 7% The type of missingness was missing at random for 18 items (items PF1, RP1, RP3, BP2, GH1, GH4, RE2 and all items of VT, SF and MH subscales) and missing not at random for the ... missingness and could confound the association between missingness and many other predictors) The PROC LOGISTIC package of SAS software (v9.1, Cary, NC, USA) was used Results Table summarizes the...
- 6
- 471
- 0
Báo cáo khoa học: "Physiological and pathological aspects of long-term storage of acorns" potx
... of food reserves In respect to these ageing processes and the more obvious physiological and pathological disintegration of the populations, it also seems to be necessary to investigate the genetic ... because of fungal invasion but, nevertheless, it was possible to assess the physiological and pathological aspects of acorn ageing Although thermotherapy was reasonably effective against attack by ... high standards required for seed storage today and In the context of a long- term storage project at the University of Hannover, the physiological development during storage and germination of...
- 4
- 166
- 0
Báo cáo lâm nghiệp: " Effects of long-term water stress on net photosynthesis, growth and water-use efficiency of conifers in the field" doc
... indicating Acknowledgments was supported by Deutsche schungsgemeinsc:haft For- References photosynthesis and growth of young (Picea abies [L.] Karst) and Douglas firs (Pseudotsuga menziesii [Mirb.] ... Results Trees receiving optimal showed the highest net water supply photosynthesis PICEA and thus also ’ fastest growth Douglas the fir was superior to spruce Net photosynthesis in trees with ... field (in German) Allg Forst Jagdztg 159, 230-239 Gross K & Pham-Nguyen T (1987a) Pressurevolume analyses on shoots of Picea abies and leaves of Coflea liberica at various tem- peratures Physiol...
- 5
- 323
- 0
Báo cáo y học: "Magnitude and determinants of nonadherence and nonreadiness to highly active antiretroviral therapy among people living with HIV/AIDS in Northwest Ethiopia: a cross - sectional study" ppsx
... medication The last indicator, having goals was assessed by asking whether the patient is developing and maintaining specific goals when living with HIV Goals could be relatively long- term, intermediate, ... Technology, College of Medicine and Health Sciences, University of Gondar, Gondar, Ethiopia 2Department of Microbiology, Immunology and Parasitology, College of Medicine and Health Sciences, University ... Medical Microbiology and Epidemiology of Infectious diseases, Faculty of Medicine, University of Leipzig, Leipzig, Germany 7Fraunhofer Institute for Cell Therapy and Immunology, Leipzig, Germany Authors’...
- 8
- 375
- 0
Báo cáo y học: "Trends and determinants of Comprehensive HIV and AIDS knowledge among urban young women in Kenya" docx
... young women, by looking at the trends and determinants of HIV and AIDS comprehensive knowledge among those who reside in urban areas and are aged 15-24 years Using data from the 1993, 1998 2003 and ... religion, and region of residence Other factors included HIV and AIDS risk perception (measured by thoughts on her chances of getting AIDS: none, small, moderate/great), whether the respondent has ... respondent has gone for HIV and AIDS testing and counselling, and whether the respondent personally knew somebody who has/had died of AIDS Methods of analysis The data was weighted during analysis...
- 8
- 396
- 0
báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx
... the ranges of social economic and cultural resources that individuals draw on in responding to long- term health conditions; • assess lay peoples’ systems of support and access to resources that ... illness-management practices Illness management involves the adoption of a set of new practices, and changes to familiar ones Changes that follow from a diagnosis of chronic illness are to a lesser or greater ... where negotiations are characterised by asymmetries of power and knowledge and to offer understandings of continuities and discontinuities in behaviours and processes involved in sustaining behaviour...
- 7
- 331
- 0
báo cáo khoa học: "DNA aneuploidy as a topographic malignant transformation pattern in a pleomorphic adenoma of long-term evolution: a case report" docx
... the fresh material (A) Histogram of group samples showing a single peak in the G0 -G1 area (DNA diploid) (B) Histogram of group samples also exhibiting a diploid pattern (C) Histogram of group ... aneuploid S-phase was 0.44% and the total S-phase fraction was 2.45% (Figure 3C) Histological analysis of Group and Group samples showed ductal structures, cords and islands of polygonal cells ... AE1/AE3 and CK in most of the epithelial cells (Figure 5C-F) p63 and a-SMA staining were seen to a lesser degree than in the Group and samples (Figure 5B-E) whereas expression of antigen Ki67 was...
- 7
- 337
- 0
Báo cáo y học: "The course of untreated anxiety and depression, and determinants of poor one-year outcome: a one-year cohort study" ppt
... (NESDA) NESDA is a multi-site naturalistic study, and aims at studying the long- term course and consequences of anxiety and depressive disorders for a period of eight years The analyses presented ... the youngest participant being 18 years of age and the oldest 65 Page of 10 Participants had an average of 12.0 years (sd 3.4 years) of education, ranging from to 18 years The majority of patients ... untreated and treated patients is given in Table The course of depression and anxiety Figures and show the results of the multilevel repeated measures ANCOVA’s, examining the course of anxiety measured...
- 10
- 280
- 0
Báo cáo khoa học: "Causes of death and determinants of outcome in critically ill patient" pot
... astonishing given the comparably large number of patients in these high-organ-failure groups (four failing organs, n = 258; five failing organs, n = 234; six failing organs, n = 121) and the mean age ... malignancy and respiratory failure as the two most common causes of death of survivors of critical illness An explanation for the high incidence of malignant tumour disease as a cause of death of ... diseases other than chronic renal pathologies The importance of renal function for the long- term prognosis of critically ill patients has already been suggested by earlier studies [45] Even though...
- 13
- 215
- 0
Báo cáo y học: "Prevalence and determinants of child maltreatment among high school students in Southern China: A large scale school based survey" docx
... month using a three-point response scale (never vs sometimes vs always) In addition, other variables measured included age, gender, place of origin (Guangdong vs non-Guangdong), housing type (lived ... participating school, two classes from Year to (age 13–15 years) were randomly chosen, resulting in a total of 144 classes, with an average class size of about 46 students) The questionnaire was self ... setting Moreover, the use of stratified random sampling strategy suggests that the results are likely to be representative of the population at large, which allows a reasonably accurate estimation...
- 8
- 360
- 0
Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt
... YQ, Feng JX, Lu LF, Sun Q, Ying G, Tang DJ, Tang H, et al.: Comparative and functional genomic analyses of the pathogenicity of phytopathogen Xanthomonas campestris pv campestris Genome Res 2005, ... host specificity of pathogens is determined by gene-for-gene interactions [10] involving avirulence (avr) genes of the pathogen and cognate resistance (R) genes of the host Disease resistance occurs ... http://genomebiology.com/2007/8/10/R218 Genome Biology 2007, Background Xanthomonas campestris pathovar campestris (Xcc) is the causal agent of black rot disease, one of the most destructive diseases...
- 26
- 322
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose