... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and ... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential...
... conveying at least two incompatible interpretations- “having more than one sense” as stated by Hurford and Heasley (2001:121) -9- Regarding paraphrasing, Hurford and Heasley (2001) assert that a word ... chapter in fact is a typical example of this (2) A man eating a kebab goes up to a lady who has a yapping Chihuahua at her heels “Can I throw your dog a bit?” he asked politely “Certainly,” came ... considered ambiguous if and only if it has at least two paraphrases that are not themselves paraphrases of one another A good case in point can be found in: (3) The chicken is ready to eat It is...
... LIST OF ABBREVIATIONS Alkaline phosphatase - ALP Alcian blue - AB Alpha fetoprotein - AFP / αFP Autologous chondrocyte implantation - ACI Ascorbic acid 2-phosphate - AA2P β-actin - BA Bone marrow ... 2.1 Articular cartilage and its associated clinical problems Articular cartilage is a unique avascular, aneural and alymphatic load-bearing tissue which is supported by the underlying subchondral ... with appearance of adult collagen isoform, Col IIB, as early as day of EB formation (Kim et al., 200 5a) In contrast, normal wild type 5-day (5‘d’) EBs only displayed Col IIB after 14 days of chondrogenic...
... clinical trails that employ adult stemcells (such as blood-forming hematopoietic stemcells and cartilage-forming cells) A potential advantage of using adult stemcells is that the patient's own cells ... DNAspindle complex is extruded through a small hole in the zona pellucida, instead of aspirating the DNA-spindle complex with a glass pipette as others have described [81] With use of an aspiration ... Miyamoto K, Hayashi K, Suzuki T, Ichihara S, Yamada T, Kano Y, Yamabe T, Ito Y Human placenta feeder layers support undifferentiated growth of primate embryonicstemcellsStemCells 2004, 22,...
... 11 Karyotype of hESCs maintained at oC for 24h by mFISH 37 Figure 12 Metaphase spread of hESCs maintained at 25 oC for 24h by mFISH 38 Figure 13 Metaphase spread of hESCs maintained at oC for ... 14 Metaphase spread of hESCs maintained at oC for 48h by mFISH 39 Figure 15 Karyotype of hESCs maintained at oC for 48h by mFISH 39 Figure 16 Metaphase spread of hESCs maintained at 25 oC for 48h ... Established mammalian cell lines and primary explanted cells from mammals are commonly used in vitro to analyze the genotoxic potential of environmental factors, drugs, biomaterials as well as chemical,...
... collection and assembly of data, data analysis and interpretation, manuscript writing and final approval of manuscript for publication YJ Provided study materials, collection of data, data analysis and ... pairs to amplify the truncated form of MsrA and introduce a BamHI cutting site at the 3’ end (MsrA -for: 5’-cctggctgcggaggtggagaaac and MsrA-BamHI-rev: 5’-tggggccaaggatccgctttgaaagaacc) The amplicons ... data, data analysis and interpretation, manuscript writing and final approval of the manuscript XH Participated in the collection and assembly of data, data analysis and interpretation, manuscript...
... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... the standard of using hESCs asa model In this study, taking hESCs differentiation towards osteogenic lineage as an example, we proposed a set of functional assays asa standard of hESCs asa model ... lines for hours following ISO 10993 standards DMSO was used as control MTS assay is a standard laboratory colorimetric assay that measures the activity of mitochondrial activity Enzyme reductase...
... weak expression of SSEA3 and TRA-1-81 A total of 200 colonies were examined for each experimental group, as well asfor the control Statistical comparison of data was performed by the Chi-squared ... clumps for serial passage was achieved through treatment with mg/ml collagenase type IV, for between to Exposure of hESC to reduced temperature After days of culture following the last serial passage, ... passages Their appearance was virtually indistinguishable from non-temperature exposed hESC (data not shown) Chromosomal Analysis of hESC after exposure to low temperature Metaphase spreads of...
... profiles of teratomas was less than that of the somatic tissues, probably because the teratomas still contained a significant number of undifferentiated proliferating cells, or all cells in teratomas ... re-methylating actions of Dnmt 3a ⁄ Dnmt3b (Fig 2) Dnmt 3a and Dnmt3b appear to function both as maintenance and as de novo methyltransferases in gene areas, and thus are crucial for the establishment of ... N Hattori and K Shiota methylation analysis Although RLGS requires a larger genomic sample than is necessary for microarray-based methods, it has advantages for analyzing genome-wide methylation...
... R WATERMAN VOLUME 273 RNA Polymerase and Associated Factors (Part A) Edited by SANKAR ADHYA VOLUME 274 RNA Polymerase and Associated Factors (Part B) Edited by SANKAR ADHYA VOLUME 275 Viral Polymerases ... KITAJIMA (5), Department of Molecular Cell Biology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita Osaka, Osaka 565-0871, Japan RAJA KITTAPPA (22), Laboratory ... Stem Cells: Hematopoietic and Vascular Cell Types STUART T FRASER, JUN YAMASHITA, L MARTIN JAKT, MITSUHIRO OKADA, MINETARO OGAWA, SATOMI NISHIKAWA, AND SHIN-ICHI NISHIKAWA 59 KENJI KITAJIMA, MAKOTO...
... CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita ... 26(2):356-363 Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, et al.: Reduced expression of the let-7 microRNAs in human lung cancers in association ... comparison of partially differentiated EB and terminal differentiated adult cells From miRNA array analysis, we identified a total of 104 differently expressed miRNAs that clearly segregate the...