0

dietary fiber and availability of nutrients a case study on yoghurt as a food model

The Complex World of Polysaccharides Edited by Desiree Nedra Karunaratne pptx

The Complex World of Polysaccharides Edited by Desiree Nedra Karunaratne pptx

Sức khỏe giới tính

... Section Sources and Biological Properties of Polysaccharides Chapter Is Chitosan a New Panacea? Areas of Application Susana P Miranda Castro and Eva G Lizárraga Paulín Chapter Yeast (Saccharomyces ... Polysaccharides as Carriers and Protectors of Additives and Bioactive Compounds in Foods 429 Rosa M Raybaudi-Massilia and Jonathan Mosqueda-Melgar Chapter 17 Dietary Fiber and Availability of Nutrients: ... Kaldas, John T Arnason and Paul A Charpentier Chapter 20 Polysaccharides from Red Algae: Genesis of a Renaissance 535 Mar a Josefina Carlucci, Cecilia Gabriela Mateu, Mar a Carolina Artuso and...
  • 648
  • 563
  • 0
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn Quốc (Trường hợp ở Hà Nội và Seoul)

Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn Quốc (Trường hợp ở Hà Nội và Seoul)

Khoa học xã hội

... gods below and the human world 1.2 The classification of Len dong and Gut 1.2.1 Classification of Len dong -Thanh Dong - Dong Co 1.2.2 Gut classification of Korea - National Gut - Village Gut - ... features within each possessed of particular and general celebration 2.4.1.2 Dance and music Hat van also known as Chau van, hat bong This is a type of Vietnamese traditional singing, also a ... worship on certain days of the year, depending on each village is different 2.2.2 The incarnations and the basic functions of incarnation ritual 2.2.2.1 The incarnations A ritual of len dong often...
  • 18
  • 813
  • 0
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn16211020150227

Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn16211020150227

Giáo dục học

... Gut on the scale of Jeong Sang Jun: Table 1.1: Classification of Gut on the its scale Small Large classification classification National Gut National Gut Classification Features -It is generally ... literature of many schools of study for a long time The classified Seoul Gut is based on the geographical classification and based on the classification of four values Geographical classification ... incarnation of a saint as to can Quan, can Co, can Cau, can Ong Hoang The ceremony usually has average at least over 10 incarnations, or 15, if more then 20 incarnatins The descending of the Saints...
  • 106
  • 507
  • 0
A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS

A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS

Kinh tế - Quản lý

... Communicative Language Teaching (CLT) is an approach to the teaching of second and foreign languages that emphasizes interaction as both the means and the ultimate goal of learning a language CLT places ... demonstration, regalia and pictures, for example, and teaches abstract vocabulary through association of ideas I.5.3 Vocabulary teaching according to the Communicative approach (CLT) Communicative ... practise and develop language functions, as well as judicious use of grammar and pronunciation focused activities 14 CHAPTER II THE CONTEXT OF TEACHING AND LEARNING VOCABULARY IN “BUSINESS BASICS”...
  • 42
  • 1,338
  • 3
Measurements and Mitigation of Peer-to-Peer-based Botnets: A Case Study on Storm Worm ppt

Measurements and Mitigation of Peer-to-Peer-based Botnets: A Case Study on Storm Worm ppt

Tổ chức sự kiện

... tables are called contacts and are organized as an unbalanced routing tree Each contact consists of the node’s DHT ID, IP address, and UDP port A peer a stores only a few contacts to peers that ... on average) The first Storm-related message we are aware of was received on December 29, 2006: It contained best wishes for the year 2007 and as an attachment a copy of the Storm binary An analysis ... reliably acquire all 32 search keys each day for a given Storm binary 4.2 Infiltration and Analysis Based on the obtained keys and knowledge of the communication protocol used by Storm, we can start...
  • 9
  • 560
  • 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Quản lý dự án

... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... organization changes which this assumed The results of the case study are articulated as a series of key factors Finally, the study closes with a discussion of the main conclusions reached CASE ... creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge and Process Management CASE STUDY Figure Irizar chart Figure Organizational success factors in...
  • 10
  • 1,063
  • 1
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học

... the a- amylase family, this module has been recognized in enzymes having six of the almost 30 specificities: a- amylase, maltotetraohydrolase, maltopentaohydrolase, maltogenic a- amylase, CGTase, and ... [86] Maltotetrao-hydrolase Maltopentao-hydrolase Maltogenic a- amylase Acarviose transferase Cyclodextrin glucanotransferase a The accession numbers with * are the numbers from GenBank Results and ... GH 13 members of this study AAM, a- amylase; M4H, maltotetraohydrolase; M5H, maltopentaohydrolase Other abbreviations (Aspka, Aspnd, etc.) are explained in Table (B) For comparison, linkers from...
  • 11
  • 615
  • 0
lecture 11 dietary fiber and vitamin analysis

lecture 11 dietary fiber and vitamin analysis

Kỹ năng viết tiếng Anh

... products) – Folate: Enzyme extraction with α-amylase, protease and γ-glutamyl hydrolase(conjugase) – Vitamins A, E, or D: Organic solvent extraction, saponification, and re-extraction with organic solvents ... unstable vitamins such as these, antioxidants are routinely added to inhibit oxidation Vitamin analysis • Bioassay Methods: – vitamins B12 and D • Microbiological Assays: – water-soluble vitamins ... growth of a certain microorganism in an extract of a vitamin-containing sample is compared against the growth of this microorganism in the presence of known quantities of that vitamin • Chemical...
  • 3
  • 242
  • 1
Population Ageing, Elderly Welfare, and Extending Retirement Cover: The Case Study of Sri Lanka potx

Population Ageing, Elderly Welfare, and Extending Retirement Cover: The Case Study of Sri Lanka potx

Sức khỏe người cao tuổi

... Participation Rate (%) SE Asia (1995) Participation South Asia Rate (%) (’95,’00) Participation Rate (%) UK 68 Malaysia 52 Sri Lanka 32 Germany 64 Thailand 67 Pakistan 16 US 72 Korea 65 India ... the cost of capital (assuming unchanged demand for capital and constraints on capital inflows) and a dampening of investment demand and growth Even if a savings-investment gap emerges, access to ... Sensitivity analysis was applied to the data to evaluate the impact of increasing female labour force participation on economic dependency levels and average years worked The latter variable was derived...
  • 104
  • 534
  • 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học

... programs WHAT IF [28] and PROCHECK [29] In each case, the stereochemical quality and the Ramachandran [30] scores were good and similar to that of the template Docking of Pi4 on rat Kv1.2 channel ... contribution of a pair of well-defined basic and aromatic residues, referred to as the functional dyad, which we attributed to Lys26 and Tyr35 in the case of Pi4, has been shown The docking of ... El Ayeb, M., Rochat, H., Allen, P.D., Pessah, I.N., De Waard, M & Sabatier, J.M (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine...
  • 10
  • 503
  • 0
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

Báo cáo khoa học

... was constructed as follows; Pfu polymerase (Stratagene) was used to amplify vanXYC using pAT704 as template with primers A (5¢-GCTAGGTCTCAATGAAC ACATTACAATT-3¢) and B (5¢-TATGGAATTCTCATG CGAACTGCCTCA-3¢) ... Lessard, I .A. D & Walsh, C.T (1999) Mutational analysis of active-site residues of the enterococcal D-Ala-D-Ala dipeptidase VanX and comparison with Escherichia coli D-Ala-D-Ala ligase and D-Ala-D-Ala ... Substrate VanXYCa D59S D5 9A VanXYCa D59S D5 9A D-Ala-D-Ala a D-Ala-D-Ala D-Ala-D-Ala UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] Km (mM) kcat (s)1) kcat/Km...
  • 7
  • 414
  • 0
Spatial modelling of air pollution in urban areas with GIS: a case study on integrated database development doc

Spatial modelling of air pollution in urban areas with GIS: a case study on integrated database development doc

Điện - Điện tử

... connections In case of the ArcGIS’s geodatabase, all the data are loaded into the relational database, so that the geospatial coordinate data of the GIS data layers are stored in the relational data ... transferred and incorporated into the GIS database, which can be useful in managing data time series To accommodate large data sets and many variables such as air quality data, climatic data, and ... Spatial modelling of air quality in this paper is mainly focused on the integration of a wide range of data in the framework of the GIS spatial database This method of data management and analysis...
  • 6
  • 497
  • 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học

... anhydrase Carbonic anhydrase Malic enzyme 1, NADP(+)-dependent Catalase UDP-glucose pyrophosphorylase Fumarylacetoacetate hydrolase Fumarylacetoacetate hydrolase Enolase 1, a non-neuron Carbonic anhydrase ... Agt), alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydrase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; Eno1, enolase 1, a non-neuron; Fah, ... results are summarized in Fig 3A In AgxtKO mice, kidney enolase was clearly overexpressed, as were liver fructose bisphosphatase and catalase, whereas liver enolase and carbonic anhydrase were...
  • 9
  • 481
  • 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

Báo cáo khoa học

... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and 5¢-T ... cytoplasmic domain span exons and 5, which also contain the stop codon as well as a 274-bp 3¢ untranslated region Alternatively splicing and expression pattern of MUC15 Database searches showed that ... mammary gland Uni-ZAP cDNA library, derived from a lactating Holstein cow (Stratagene, La Jolla, CA, USA), using MUC15-specific First-strand cDNA was prepared from the mammary gland RNA of a Danish...
  • 9
  • 614
  • 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

Báo cáo khoa học

... tumoricidal activity in the casein fraction was obtained after low pH precipitation of human milk [2,7] and the protein component of the casein fraction was identified as a- lactalbumin, a whey protein ... and was subsequently eluted after raising the salt concentration in the elution buffer to m NaCl The major component of the eluate was a- lactalbumin and the fraction was Structure and function ... [48,49], accompanied by cytochrome c release, proapoptotic caspase activation and exposure of phosphatidylserine on the cell surface [49] Apoptosis was not the cause of cell death, however, as caspase...
  • 12
  • 525
  • 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

Báo cáo khoa học

... CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG ... Oligonucleotide Sequence (5¢- to 3¢) PCR template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG ... nanograms of pPic9Kmpaf were used as a PCR template to generate the mutations: PAFK 9A (plasmid pPic9KpafK 9A) , PAFK3 5A (plasmid pPic9KpafK3 5A) and PAFK3 8A (plasmid pPic9KpafK3 8A) For generation...
  • 16
  • 408
  • 0
Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

Báo cáo khoa học

... illustrates the same fractionation by cation exchange chromatography of the IB fraction In the latter case, only a single peak was detected, eluted at the same concentration of ammonium acetate as for ... preparation) and the pelleted fraction, after solubilization and renaturation (see Methods), called IB preparation The S and IB preparations were fractionated in parallel by size exclusion chromatography ... tested by comparative model validation using anolea [30,31] and prosaii [32] Buried residues belonging to b-strands and facing the intradomain hydrophobic core of each domain, as well as other buried...
  • 13
  • 442
  • 0
báo cáo hóa học:

báo cáo hóa học: " CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson’s disease" pot

Toán học

... Apomorphine-induced rotational behaviour was assessed at and 21 days after 6-OHDA-injection Rotational behaviour was tested in rotometer bowls [47] Five minutes after intraperitoneal administration of apomorphine ... injection Then, apomorphine-induced rotational behaviour was analyzed to assess unilateral degeneration of presynaptic dopaminergic neuron terminals at and 21 days after 6OHDA injection Although rats ... exhibit more characteristics of activation [30] They are aggregated, less ramified and have shorter glial processes, as well as a disordered arrangement and increased expression of CD11b and CD45 Moreover,...
  • 12
  • 359
  • 0
báo cáo hóa học:

báo cáo hóa học: " A case study on co-exposure to a mixture of organic solvents in a Tunisian adhesive-producing company" potx

Hóa học - Dầu khí

... Energy and Environment Laboratory, National school of Engineers, Sfax University, Sfax - Tunisia 2University laboratory of Occupational Medicine and Occupational Hazards, EA 2690 Poisons and occupational ... - France Authors’ contributions IG was involved in the conception and design of the project, data collection, data analysis, data interpretation, manuscript writing, and final approval of manuscript ... stationary samplings were taken The personal sampler holder was set near the respiratory person track whereas the stationary sampler was fixed on the earth and kept at the middle height of an...
  • 8
  • 641
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

Báo cáo khoa học

... stneiciffeoc yassa-retni dna -artni eht dna lm/gn 80.0 saw ytivitisnes yassa ehT )ASU ,stcudorP citsongaiD( tik yassaonummioidar laicremmoc a gnisu detcudnoc erew syassa enoretsegorp eht litnu Co02– ta derots ... laminA oãçudorpeR ed arielisarB atsiveR riG a ar ad sacav me oãçaluvo ad oãçazinorcnis e ralucilof acimâniD MC sorraB ,C ohlitsaC ,PBM arieroM ,GLA inibmaG 236-916 ,3 ,7891 tcarP minA dooF mA ... deM sarB qrA anivob aemêf ad latineg oãgró od asonev arutetiuqraoignA DJ seãramiuG ,RAT aluaP ,CAC sednanreF ,PE atsoC ,MM osoiG 11 2991 ,snialP ssorC ,secivresiuqE ,092-432 pp de dn stcepsA deilppA...
  • 4
  • 223
  • 0

Xem thêm