convolution representation of a solution
Báo cáo hóa học: "Research Article Asymptotic Representation of the Solutions of Linear Volterra Difference Equations" pdf
... behavior of a linear delay difference equation,” Proceedings of the American Mathematical Society, vol 115, no 1, pp 105–112, 1992 13 S Elaydi, S Murakami, and E Kamiyama, “Asymptotic equivalence ... Difference Equations, pp 111–133, Taylor & Francis, London, UK, 2002 15 J R Graef and C Qian, “Asymptotic behavior of a forced difference equation,” Journal of Mathematical Analysis and Applications, ... estimates of solutions of difference equations,” Journal of Mathematical Analysis and Applications, vol 94, no 1, pp 181–192, 1983 19 W F Trench, “Asymptotic behavior of solutions of Poincar´ recurrence...
- 22
- 262
- 0
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... for Spoken Dialogue Performance Analysis In Proc of EMNLP M Walker, D Litman, C Kamm and A Abella 2000 Towards Developing General Models of Usability with PARADISE Natural Language Engineering ... is not always available and users have to activate it manually Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g talking heads (Graesser et al., 2003)) ... Intelligence in Education, 16 C Rich and C L Sidner 1998 COLLAGEN: A Collaboration Manager for Software Interface Agents User Modeling and User-Adapted Interaction, 8(3-4) M Rotaru and D Litman 2006 Exploiting...
- 8
- 515
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... the set of properties that John has THE FIRST MECHANISM - EXTERNAL MANAGEMENT The mechanism that evaluates a formula with respect to a model has been augmented with a table that contains each ~-expression ... presence of intensional substitution failure is one of the important tests of a theory of propositional attitudes This mechanism is a correlate of that of Thomason [1980], with the addition of meaningful ... and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, the correct denotational relationship is maintained by expanding the image...
- 3
- 394
- 0
Báo cáo khoa học: "A STRUCTURED REPRESENTATION OF WORD-SENSESIR OR SEMANTIC ANALYSIS" pdf
... based on a context free grammar [ANT87] Italian syntax is also more complex than English: in fact, sentences are usually composed by nested hypotaetical phrases, rather than linked paratactical ... circles are replaced by brackets and parenthesis Arrows indicate the direction of the relations among concepts find a clear correspondence between the words of natural language and conceptual categories ... expectations are associated to the words employed, as for canonical graphs; in the second case, they are associated to some abstraction of a word, as for example in Wilk's formulas [ W l L ] and...
- 9
- 358
- 0
Báo cáo "Algorithm for solution of a routing problem " pot
... Find an optimal tour for Problem A and B with the following input data (the source a4 and the sink a1 1 for Problem A) : vertices altitude a1 a2 a3 a4 a5 a6 a7 a8 a9 a1 0 16 a1 1 11 a1 2 a1 3 15 a1 4 ... a1 5 a1 6 16 a1 7 11 We first renumber the vertices in increasing of altitudes We see that a4 ↔ 6, a1 1 ↔ 12, so we have b = and e = 12 vertices altitude renum a9 a2 a5 a1 2 a1 5 4 a4 a3 a6 a7 a1 a8 ... talk given at the Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam...
- 5
- 344
- 0
Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt
... sentence is a potential garden path in a psych~ logically plausible way The semantic knowledge plays a fundamental role in choosing a particular analysis Milne argues that a one-word lookahead, with ... the at tachment of a role to a verb (a REF node to a REL node via a CONN node); of course, the attachment of a new case cannot trigger a simple case check, but must take into account also all ... not appear in a node of fig.l is the auxiliary "hanno" Auxiliaries have been consid ered as components of the verb, so that their presence is signalled only by means of an AUX role The actual auxiliary,...
- 8
- 412
- 0
Báo cáo khoa học: "REPRESENTATION OF FEATURE SYSTEMS IN A NON-CONNECTIONIST MOLECULAR MACHINE" pptx
... Laszl6 and Andras Kornai 1985 A finite-state approach to generation and parsing Paper presented at the Generative Grammar Fiesta, Salzburg K~im~n, I~szl6 1986 Semantic interpretation in a dynamic ... can perform extra actions when receiving a properly addressed message That is, the message acts as a p r o g r a m that will, after some modifications it undergoes, activate a set of output m o ... characterizing a language where plural and dual n o u n s u s u a l l y b e h a v e in the same w a y (e.g H e b r e w ) : In this machine, each molecule c o n t a i n s a m o r e or less s t a...
- 4
- 273
- 0
a representation of the true meaning of tragedy
... Suffering was a major step in coaxing John to his realization He suffered mentally and emotionally because of his flaw, as the heat of the accusations intensified He witnessed his wife Elizabeth go ... possibilities of human freedom.'(Kerr) Again, it is Proctor's freedom that makes him a tragic hero 'I cannot mount the gibbet like a saint It is a fraud, I am not that man My honesty is broke, Elizabeth; ... the agony of being accused as a witch he suffers because he too was accused of betraying God Their true suffering becomes apparent when Proctor confesses to adultery to pardon Elizabeth Elizabeth...
- 2
- 319
- 0
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt
... Statistics for the total amount of experimental data are reported in Table A simulated annealing (SA) procedure was used starting from a randomly generated linear polypeptide chain The actual ... inammation-mediating proteases [16] More recently, a number of patents on the use of BBIs against various apparently unrelated diseases have appeared [1719] The molecular basis of these BBI activities ... bovine pancreas), a- chymotrypsin (TLCK-treated from bovine pancreas), BApNA and GPpNA were purchased from Sigma-Aldrich Solutions of BApNA and GPpNA were freshly prepared by dissolving suitable amounts...
- 16
- 518
- 0
Đề tài " Analytic representation of functions and a new quasianalyticity threshold " doc
... Annals of Mathematics, 164 (2006), 1033–1064 Analytic representation of functions and a new quasi-analyticity threshold By Gady Kozma and Alexander Olevski˘ ı* Abstract We characterize ... boundary value of a Nevanlinna class function That example is L∞ and can be made continuous, but it cannot be made smooth in any reasonable sense without leaving the Nevanlinna class 2.4 The harmonic ... (Russian), Gosudarstv Izdat Tehn.-Teor Lit., Moscow, 1950 [S95] F A Shamoyan, Characterization of the rate of decrease of the Fourier coefficients of functions of bounded type and of a class of analytic...
- 33
- 293
- 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG ... (Table ) Loop (9–12) and loop (18–23) create a b-turn A characteristic of the PAF loop regions is the recurring asparagine–aspartate or aspartate–asparagine (Asn18– Asp19, Asp32–Asn33, Asp39–Asn40)...
- 16
- 408
- 0
Báo cáo Y học: Solution structure of a hydrophobic analogue of the winter flounder antifreeze protein doc
... HN Ha Hb Asp1 Val2 Ala3 Ser4 Asp5 Ala6 Lys7 Ala8 Ala9 Ala10 Glu11 Leu12 Val13 Ala14 Ala15 Asn16 Ala17 Lys18 Ala19 Ala20 Ala21 Glu22 Leu23 Val24 Ala25 Ala26 Asn27 Ala28 Lys29 Ala30 Ala31 Ala32 ... Liepinsh et al (Eur J Biochem 269) Table Sequence alignment of TTTT and VVVV2KE TTTT VVVV2KE D D TASDAAAAAAL VASDAKAAAEL 13 TAANAKAAAEL VAANAKAAAEL hydrogen bonds involving the hydroxyl groups of the ... constants [26] The COSY and TOCSY cross-peaks were visually inspected to determine the relative magnitude of the JHa,Hb couplings of CbH2 methylene groups The ROESY 24 TAANAAAAAAA VAANAKAAAEA 35...
- 8
- 337
- 0
báo cáo hóa học: " Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pptx
... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self-report measures were calculated Differences between male and female participants and between ... one diabetes-related complication Patients completed the questionnaires as part of the annual review at the Diabetes Page of (page number not for citation purposes) Health and Quality of Life ... study was to evaluate the validity of the PRIMS-RII as a measure of suffering in people with diabetes Although the concept of suffering is abstract, the vast majority of patients was able to...
- 7
- 410
- 0
báo cáo hóa học:" Representation to the Accident and Emergency department within 1-year of a fractured neck of femur" ppt
... falls, 57 fractures, head injures) required acute care because of a fall A fall may not have been the offending mechanism in all cases—some patients may have sustained pathological fractures or ... results of this review revealed that the causes of representation and readmission are variable and frequently multifactorial Falls, fracture and infection were the leading causes of readmission ... for Trauma (BOAST), 2007 www.boa.ac.uk (last accessed 09/02/2011) National Hip Fracture Database (NHFD) The National Hip Fracture Database National Report 2010 www.nhfd.co.uk (last accessed 09/02/2011)...
- 16
- 395
- 0
báo cáo hóa học:" Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pdf
... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self-report measures were calculated Differences between male and female participants and between ... one diabetes-related complication Patients completed the questionnaires as part of the annual review at the Diabetes Page of (page number not for citation purposes) Health and Quality of Life ... study was to evaluate the validity of the PRIMS-RII as a measure of suffering in people with diabetes Although the concept of suffering is abstract, the vast majority of patients was able to...
- 7
- 395
- 0
Báo cáo toán học: " Existence of solutions of a new system of generalized variational inequalities in Banach spaces" ppt
... Existence of solutions of a new system of generalized variational inequalities in Banach spaces Somyot Plubtieng∗ and Tipphawan Thammathiwat Department of Mathematics, Faculty of Science, Naresuan University, ... Singh, SP: An altenate version of a variational inequality Indian J Math 41, 25–31 (1999) 12 Kassay, G, Kolumb´n, J: System of multi-valued variational variational inequalities Publ a Math Debrecen ... nonlinear mixed variational inequalities in Hilbert spaces J Convex Anal 11, 235–243 (2004) 17 15 Li, JL: On the existence of solutions of variational inequalities in Banach space J Math Anal Appl...
- 21
- 387
- 0
Báo cáo hóa học: " Uniqueness of positive solutions to a class of semilinear elliptic equations" potx
... modification to [8] Lemma 3.2 Assume a Î N and f(t,u) satisfies (F1), then (H1) j(t ,a) vanishes at least once and at most finitely many times in (a, b (a) ), (H2) if
- 9
- 343
- 0
Báo cáo hóa học: " On existence and uniqueness of positive solutions to a class of fractional boundary value problems" pot
... Zhao, Y, Sun, S, Han, Z, Li, Q: Positive solutions to boundary value problems of nonlinear fractional differential equations Abs Appl Anal 2011, Article ID390543 (2011) 19 Harjani, J, Sadarangani, ... Fractional Calculus and Fractional Differential Equations Wiley, New York (1993) 10 Podlubny, I: Fractional Differential Equations Academic Press, San Diego (1999) 11 Lakshmikantham, V, Vatsala, AS: ... nonlocal fractional boundary value problem Nonlinear Anal 72, 916–924 (2010) doi:10.1016/j.na.2009.07.033 17 Zhang, S: Existence of solution for a boundary value problem of fractional order Acta Math...
- 9
- 418
- 0
báo cáo hóa học: " On existence and uniqueness of positive solutions to a class of fractional boundary value problems" ppt
... Zhao, Y, Sun, S, Han, Z, Li, Q: Positive solutions to boundary value problems of nonlinear fractional differential equations Abs Appl Anal 2011, Article ID390543 (2011) 19 Harjani, J, Sadarangani, ... Fractional Calculus and Fractional Differential Equations Wiley, New York (1993) 10 Podlubny, I: Fractional Differential Equations Academic Press, San Diego (1999) 11 Lakshmikantham, V, Vatsala, AS: ... nonlocal fractional boundary value problem Nonlinear Anal 72, 916–924 (2010) doi:10.1016/j.na.2009.07.033 17 Zhang, S: Existence of solution for a boundary value problem of fractional order Acta Math...
- 9
- 415
- 0
Báo cáo hóa học: " Convergence theorems of solutions of a generalized variational inequality" doc
... inverse-strongly monotone mappings Nonlinear Anal 2005, 61:341-350 24 Iiduka H, Takahashi W: Weak convergence of a projection algorithm for variational inequalities in a Banach space J Math Anal Appl 2008, 339:668-679 ... convergence of a general iterative algorithm for equilibrium problems and variational inequality problems Math Comput Model 2008, 48:1033-1046 22 Iiduka H, Takahashi W, Toyoda M: Approximation of solutions ... acretive mappings in Banach spaces J Math Anal Appl 1995, 194:114-125 doi:10.1186/1687-1812-2011-19 Cite this article as: Yu and Liang: Convergence theorems of solutions of a generalized variational...
- 10
- 185
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25