chemistry quality and functional properties of grains of paradise aframomum melegueta a rediscovered spice
Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc
... (forward) and 5¢-TCCAGGCTGCACTGCTCACTC-3¢ (reverse) Each sample was normalized to reference genes: elongation factor (EF-2), 5¢-GACATCACCAAGGGTGTGCA-3¢ (forward) and 5¢-TTCAGCACACTGGCATAGAGGC-3¢ ... radioactively labelled MCPIP cDNA probe and visualized by autoradiography A b-actin probe served as a control for equal loading A single 2.0 kb band was seen in all lanes A 1.8 kb actin isoform ... sufficient to guarantee the appearance of functional proteins As reported by Kaspar and Gehrke [18] and Dinarello [19], stimulation of macrophages by mild stimulants (such as C 5a complement or...
- 14
- 598
- 0
Báo cáo khoa học: Quaternary structure and functional properties of Penaeus monodon hemocyanin docx
... Homarus americanus (H) and Astacus leptodactylus (A) are used as markers for the hexameric (1 · 6) and dodecameric (2 · 6) aggregation state, respectively A Fractogel XK 26 ⁄ 100 preparative grade ... presence of 10 mm EDTA shows the persistence of the dodecameric aggregation state (Fig 4A, peak a) with the appearance of only a small fraction of the hexameric form (Fig 4A, peak b) and of monomers ... eluting as fractions and in the preparative chromatography of Fig was analyzed by light scattering (Fig 3) In Fig 3A the distribution of molar mass in the elution Penaeus, such as P semisulcatus and...
- 16
- 394
- 0
Báo cáo y học: "Expression and functional properties of antibodies to tissue inhibitors of metalloproteinases (TIMPs) in rheumatoid arthritis" docx
... proximal interphalangeal, metacarpophalangeal, carpal, and metatarsophalangeal and interphalangeal joints of forefeet The presence of a single erosion was sufficient to fulfil the requirement of an ... synovial fluids from patients with rheumatoid arthritis Arthritis Rheum 2001, 44:2503-2511 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and ... Kojima T, Iwata H, Ionescu M, Poole AR: Relationships of matrix metalloproteinases and their inhibitors to cartilage proteoglycan and collagen turnover and inflammation as revealed by analyses of...
- 9
- 392
- 0
Báo cáo y học: "Genotypic and functional properties of early infant HIV-1 envelop" doc
... technical assistance provided by Kristina McNeal, Robin Brody, John Latino, and Linda Lambrecht We thank Margaret McManus and Dr Stephen Baker for statistical analyses, Wanda DePasquale for manuscript ... and how it can be stopped Top HIV Med 2004, 12:100-103 Haaland RE, Hawkins PA, Salazar-Gonzalez J, Johnson A, Tichacek A, Karita E, Manigart O, Mulenga J, Keele BF, Shaw GM, Hahn BH, Allen SA, ... Highlighter alignments (data not shown) of each mother-infant pair demonstrated probable transmission of a single maternal variant to infants P1189, P1049, and P1046, two variants to infant P1031 and...
- 14
- 312
- 0
Báo cáo y học: "Analysis of proteomic profiles and functional properties of human peripheral blood myeloid dendritic cells, monocyte-derived dendritic cells and the dendritic cell-like KG-1 cells reveals distinct characteristic" doc
... phenotypic, functional and electrophysiological characteristics of KG-1 cells Immunol Lett 2004, 92:97-106 Watarai H, Hinohara A, Nagafune J, Nakayama T, Taniguchi M, Yamaguchi Y: Plasma membrane-focused ... incubated at room temperature for h and washed times as above ABTS® Peroxidase Substrate (100 μl at mg/ml) (Roche) was added to each well and 30 minutes later the absorbance was measured at 405 ... Typically, ten data collection events were combined to generate each spectrum Data acquisition was achieved by randomly sampling from the target well anti-FGG (Abnova) and anti-APRC2 (Abnova) antibodies...
- 13
- 417
- 0
Novel biochemical and functional properties of the HPV 16 oncoprotein e6
... GAGAAAGTCTTCAAACAGTACGCTAACGACAACGGTGTTGACGGTGAA TGGACCTACGACGACGCTACCAAAACCTTCACCGTTACCGAACATATG TTCCAGGACCCGCAGGAACGTCCGCGTAAACTGCCGCAGCTGTGCACC GAACTGCAGACCACCATCCACGACATCATCCTGGAATGCGTTTACTGC ... GAACTGCAGACCACCATCCACGACATCATCCTGGAATGCGTTTACTGC AAACAGCAGCTGCTGCGTCGTGAAGTTTACGACTTCGCTTTCCGTGACC TGTGCATCGTTTACCGTGACGGTAACCCGTACGCTGTTTGCGACAAATG CCTGAAATTCTACTCTAAAATCTCTGAATACCGTCACTACTGCTACTCT CTGTACGGTACCACCCTGGAACAGCAGTACAACAAACCGCTGTGCGAC ... CTGTACGGTACCACCCTGGAACAGCAGTACAACAAACCGCTGTGCGAC – RESULTS (PART 1) 46 CTGCTGATCCGTTGCATCAACTGCCAGAAACCGCTGTGCCCGGAAGAA AAACAGCGTCACCTGGACAAAAAACAGCGTTTCCACAACATCCGTGGT CGTTGGACCGGTCGTTGCATGTCTTGCTGCCGTTCTTCTCGTACCCGTCG TGAAACCCAGCTGCACCACCACCACCACCACTAG)...
- 139
- 400
- 0
Báo cáo sinh học: " Likelihood and Bayesian analyses reveal major genes affecting body composition, carcass, meat quality and the number of false teats in a Chinese European pig line" ppsx
... per chain, so that a total of 300 samples were available per trait Monte Carlo standard errors were low for all trait × parameter combinations Independence of the samples was tested by an analysis -of- variance ... Figure Marginal posterior distributions of polygenic ( ) and major gene ( ) variance ratios for average backfat thickness (ABT), carcass fat depths (X2 and X4) and carcass lean depth (X5), Napole ... percentage of data removed from the initial data set was 8.5% for X2, X4 and X5, 10.7% for TTN, GTN, FTN, ABT and D20100 and 34% for NTY 388 M.-P Sanchez et al 2.3 Data adjustment and transformation...
- 18
- 247
- 0
Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt
... compilation ª 2009 FEBS N Xiao et al A Antifreeze protein from ascomycetous fungus AnpAFP TisAFP AnpAFP B A. Acid Asx 10 20 AGLDLGAASX FGALAFEGVA AGPSAVPLGT AGNYVI LAST AGPTAVPLGT AGNYAI LAST AGPTAVPLGT ... transcribed spacer (ITS) region of genomic recombinant DNA was amplified using the primer pairs ITS1-F (5¢-CTTGGTCATTTAGAGGAAGTAA) and ITS4-B (5¢-CAGGAGACTTGTACACGGTCCAG), according to Gardens and ... indicative of the binding of these hyperactive AFPs to both pyramidal and basal planes of a seed hexagonal ice crystal Comparison of TH activity between AnpAFP and TisAFP8 Figure 5A shows the results of...
- 10
- 433
- 0
Báo cáo khoa học: "The of 4 quality and wood properties provenances of South-African-grown" potx
... eastern Transvaal The trials consist of various provenances of P oocarpa and P tecunumanii as well as a number of commercial controls, ie P patula, P elliottii and P taeda The experimental lay-out ... recorded as negative and right-hand angles as positive In the statistical analysis a constant of 20° was added to all grain angle values to avoid the possibility of zero means and very large coefficients ... than P patula and is prone to the formation of star-shaped cracks filled with resin (Poynton, 1979) P taeda comprises about 9% of the total pine plantation area It has an average wood density of...
- 10
- 160
- 0
Báo cáo y học: "Natural selection of protein structural and functional properties: a single nucleotide polymorphism perspect" potx
... the statistical analysis JL and ZZ drafted the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available Additional data file ... paralog No paralog Presence of paralog V Pri Eu Un Hu A Ma ma ka ive ma mm erteb nima ryo rsa te n l rat al te l e Protein age Figure SNP A/ S3ratios and evolutionary variables SNP A/ S ratios and ... S2 conAdditionalandfile correlation andgroups of proteins.theanafter SNP and file Acknowledgements We thank Kiran Mukhyala and Reece Hart for technical assistance, Joshua Kaminker, Peter Haverty,...
- 17
- 312
- 0
Functional and structural properties of molecular soy protein fractions
... are a group of sulphated linear polysaccharides of D-galactose, and 3,6 anhydro-D-galactose (Trius and Sebranek, 1996) Carrageenans can exist as negatively charged polymers over a wide range of ... characteristics (Kasapis and Al-Marhoobi, 2005; Tolstoguzov, 1998; Braudo, 1998) Hydrocolloids such as κ-carrageenan, xanthan gum and propylene glycol alginate are able to hold and maintain water ... of 11S and 11S + κ-carrageenan mixture Table 4.3 The effect of carrageenan on gelling with various salt-coagulants Table 4.4 Analysis results of “gel” mixtures with addition of carrageenan Table...
- 170
- 308
- 0
Electronic and Optoelectronic Properties of Semiconductor Structures
... respectively A square of area a2 has four atoms on the edges of the square and one atom at the center of the square The atoms on the square edges are shared by a total of four squares The total number of ... Generation of a new effective substrate: We have noted that in semiconductor technology, high quality substrates are only available for Si, GaAs and InP (sapphire and quartz substrates are also available ... Chicago and is Professor of Electrical Engineering and Computer Science at the University of Michigan, Ann Arbor He has held visiting positions at the University of California, Santa Barbara and...
- 559
- 435
- 0
Tài liệu Báo cáo " The effect of cobalt substitution on structure and magnetic properties of nickel ferrite " pptx
... Köln, 1993 Sonal Singhal, J.Singh, S.K Barthwal, K.Chandra, Preparation and characterization of nanosize nickel-substituted cobalt ferrites (Co1-xNixFe2O4), Journal of Solid State Chemistry, Vol ... Feng Bao,Yong Qin, Synthesis and magnetic properties of nickel ferrite nano-octahedra, Journal of Solid State Chemistry, Vol 178 (2005) 2394 [5] Abdullah Ceylan, Sadan Ozcan, C Ni, S Ismat Shah, ... where a, b, c are constants; N1 and N2 are demagnetization factors determined along two perpendicular directions; λS – magnetostriction and τ- mechanical strain N.K Dung, N.H Tuan / VNU Journal of...
- 7
- 729
- 0
Tài liệu Physical health and functional ability of an elderly, population in Sri, Lanka doc
... WHO/SEARO and the technical assistance by Professor Gary Andrews, Centre for Aging Studies, Flinders University of South Australia, Adelaide, Australia We wish to thank Dr Joe Fernando Secretary, ... repeat the words, and, even if one word was repeated incorrectly, it was recorded as 'impaired hearing' D N Fernando and R de A Seneviratna Assessment of functional ability was made on the responses ... ability to eat, dress, take care of appearance, walk, go to toilet, get in/out of bed, take a bath Other activities are referred to as "instrumental ADL (IADL)" and included ability to travel outside,...
- 8
- 462
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a possible tumor-suppressor gene, is frequently silenced in oral squamous-cell carcinomas by aberrant promoter ... regulatory ligands for PRTFDC1 The catalytic efficiency and substrate specificity of PRTFDC1 was further characterized using a radiochemical assay with tritium-labeled bases as substrates, whereas ... and the data are given as the mean ± SD kcat was calculated using Mw (HPRT) = 27132 Da and Mw (PRTFDC1) = 28226 Da The kcat ⁄ Km for HPRT was set to 100% as a reference for both substrates, and...
- 11
- 770
- 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered ... bold and underlined The F13 3A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) ... the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As...
- 12
- 656
- 0
Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function pptx
... Klebsiella pneumoniae, Branhamella catarrhalis and the pathogenic fungi A fumigatus and C albicans Our results indicate that trappin-2 has a broad antibacterial activity and is fungicidal for A fumigatus ... immunomodulatory, antibacterial, antifungal and antiviral functions [1] SLPI and elafin ⁄ trappin-2 both have antimicrobial activity against Gram-negative and Gram-positive bacteria SLPI is active against ... fungicidal activity against Aspergillus fumigatus and Candida albicans, in addition to its antibacterial properties [13] This has been attributed to its N-terminal domain and is comparable to that of...
- 13
- 610
- 0
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... fit of the Ca atoms of the catalytic triad, are positional homologs of the R148 and K300 residues of P furiosus archaeal primase, both of which are known to play a pivotal role in the activity of ... polyacrylamide containing m urea) The radioactive signals were visualized by autoradiography and quantified using a Molecular Dynamics Bio-Rad PhosphorImager (quantity one software) DNA polymerase ... technical assistance and helpful discussion and to Dr Gabriella Fiorentino, Dr Pietro Amodeo and Dr Francesca Maria Pisani for critical reading of this manuscript This work was grant-aided by...
- 14
- 620
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25