Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target Louise Egeblad-Welin1, Martin Welin2,*, Liya Wang1 and Staffan Eriksson1 Department of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural Sciences, Uppsala Biomedical Centre, Sweden Department of Molecular Biology, Swedish University of Agricultural Sciences, Uppsala Biomedical Centre, Sweden Keywords bacterial UMP kinase; Mollicutes; mycoplasma; subunit interaction; Ureaplasma parvum Correspondence S Eriksson, Department of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural Sciences, Box 575, Biomedical Center, S-751 23 Uppsala, Sweden Fax: +46 18550762 Tel: +46 184714187 Email: Staffan.Eriksson@afb.slu.se *Present address Structural Genomics Consortium, Karolinska Institutet, Stockholm, Sweden Database The structure has been submitted to the Protein Data Bank under the accession number 2va1 The crystal structure of uridine monophosphate kinase (UMP kinase, UMPK) from the opportunistic pathogen Ureaplasma parvum was determined and showed similar three-dimensional fold as other bacterial and archaeal UMPKs that all belong to the amino acid kinase family Recombinant UpUMPK exhibited Michaelis–Menten kinetics with UMP, with Km and Vmax values of 214 ± lm and 262 ± 24 lmolỈmin)1Ỉmg)1, respectively, but with ATP as variable substrate the kinetic analysis showed positive cooperativity, with an n value of 1.5 ± 0.1 The end-product UTP was a competitive inhibitor against UMP and a noncompetitive inhibitor towards ATP Unlike UMPKs from other bacteria, which are activated by GTP, GTP had no detectable effect on UpUMPK activity An attempt to create a GTP-activated enzyme was made using site-directed mutagenesis The mutant enzyme F133N (F133 corresponds to the residue in Escherichia coli that is involved in GTP activation), with F133A as a control, were expressed, purified and characterized Both enzymes exhibited negative cooperativity with UMP, and GTP had no effect on enzyme activity, demonstrating that F133 is involved in subunit interactions but apparently not in GTP activation The physiological role of UpUMPK in bacterial nucleic acid synthesis and its potential as target for development of antimicrobial agents are discussed (Received 29 June 2007, revised 19 October 2007, accepted 22 October 2007) doi:10.1111/j.1742-4658.2007.06157.x Ureaplasma parvum belongs to the class Mollicutes, which have the smallest genomes known in any freeliving organisms, and a very low G + C content [1] It is a human pathogen that normally colonizes the urogenital tract, where it is involved in a variety of diseases such as urethritis and prostatitis During pregnancy, it is an opportunistic pathogen and can cause spontaneous abortions and premature birth The bacteria can be transferred vertically from mother to child during birth, and give rise to meningitis and pneumoniae in newborns [2] U parvum uridine monophosphate kinase (UpUMPK) (EC 2.7.4.22), coded by the PyrH gene, catalyses the reversible phosphorylation of uridine monophosphate (UMP) using a nucleoside triphosphate (NTP) as phosphate donor [3,4] It has been cloned and the recombinant enzyme characterized [4] UpUMPK has high sequence identity to other UMPKs from bacteria and archaea (Fig 1); the sequence identity to UMPKs from Escherichia coli, Pyrococcus furiosus, Sulfolobus solfataricus, Haemophilus influenzae and Streptococcus pneumoniae is 34, 26, 25, 34 and 38%, respectively The Abbreviations NDPK, nucleoside diphosphate kinase; UMPK, uridine monophosphate kinase FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6403 UMP kinase from Ureaplasma parvum L Egeblad-Welin et al Bacteria specific loop Archaea specific loop Fig Sequence alignment of UMPKs Accession numbers: H influenzae, P43890; E coli, P0A7E9; N meningitidis, P65931; St pneumoniae, Q97R83; Streptococcus pyogenes, P65938; B subtilis, O31749; U parvum, Q9PPX6; S solfataricus, Q97ZE2; P furiosus, Q8U122 Secondary elements for U parvum UMPK are listed above the alignments Completely conserved residues are colored in red and similar residues in yellow primary sequence and crystal structures of E coli UMPK and the archaea P furiosus and S solfataricus UMPKs showed that these enzymes belong to the amino acid kinase family [5–8] In eukaryotic cells, the corresponding enzyme is CMP-UMPK (EC 2.7.4.14), which is a member of the nucleoside monophosphate kinase family [9] Studies with Mycoplasma genitalium using transposon mutagenesis showed that UMPK is essential for the survival of the organism [10,11] The UMPKs (PyrH genes) of E coli, H influenzae and St pneumoniae have also been shown to be essential [12–14] Therefore, UMPK is a potential drug target for the development of antimicrobial agents, and it is of great 6404 importance to study the structure and function of these enzymes E coli, Bacillus subtilis and St pneumoniae UMPKs are hexamers and are activated by GTP, inhibited by UTP, and show Michaelis–Menten kinetics with UMP Furthermore, St pneumoniae UMPK displays positive cooperativity with ATP [5,14–16], as was also recently shown with the enzymes from other Grampositive bacteria, e.g B subtilis and Staphylococcus aureus [17] In E coli, UMPK residues Arg62, Asp77, Thr138 and Asn140 have been suggested to be involved in the interaction with GTP, as mutation of these residues abolished the GTP activation [6,18] However, S solfataricus UMPK is not activated by FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS L Egeblad-Welin et al UMP kinase from Ureaplasma parvum GTP, which was previously suggested to be specific to archaeal UMPKs [8] In this study, recombinant UMPK from U parvum was enzymatically characterized, particular with regard to the substrates UMP and ATP, the inhibitor UTP and the potential activator GTP The crystal structure was determined by X-ray crystallography in complex with a phosphate ion A cross-talk region between two subunits of UpUMPK was identified, which corresponded to the region in E coli UMPK that contains the key residues Thr138 and Asn140 that are involved in GTP activation Residue Phe133 of UpUMPK (corresponding to Asn140 in E coli UMPK, Fig 1) was mutated to either Asn or Ala, and the resulting mutant enzymes were characterized A Results α2 B Overall structure The structure of the UpUMPK was determined by ˚ X-ray crystallography to a resolution of 2.5 A with a final R value of 23.3% and Rfree of 28.5% (Table 1) The enzyme is a hexamer composed of three dimers that are related by threefold symmetry (Fig 2A) The monomer subunit consists of an a ⁄ b-fold with a ninestranded twisted b-sheet surrounded by eight a-helices α3 α7 β4 α5 Parameter P21 a, 79.8 b, 96.6 c, 96.3 b, 105.8 One hexamer 33.4–2.5 (2.64) 99.9 (99.9) 11.7 (41.5) 11.4 (3.1) 3.8 182 623 48 558 ESRF, ID14 eh4 0.976 100 23.3 28.5 Content of asymmetric unit ˚ Resolution (A) Completeness (%) Rmeas (%) I ⁄ rI Redundancy Number of observed reflections Number of unique reflections Beam line ˚ Wavelength (A) Temperature (K) R (%) Rfree (%) rmsds ˚ Bond length (A) Bond angle (°) ˚ Mean B value (A2) 0.007 1.04 34.7 β3 β6 Value Space group ˚ Cell dimensions (A,°) η1 α4 Table Data collection and refinement statistics Values in parentheses refer to the data in the highest-resolution shell ESRF, European synchrotron radiation facility β5 β8 α6 β9 β7 β2 α1 β1 α8 Fig (A) UpUMPK as a hexamer; a phosphate ion is seen in every monomer The dimeric couples A + B, C + D and E + F are colored green, pink and blue, respectively (B) The monomer of UpUMPK in complex with a phosphate ion The flexible loop that was only observed in one subunit is colored in orange and one 310 helix (Fig 2B) The monomers are similar, and when each subunit (B, C, D, E and F) is superpositioned on subunit A, the rmsd varies between ˚ 0.169 and 0.419 A A flexible loop between b5 and b6 (amino acids 166–175) can only be traced in the electron density for the E subunit, with B factors of ˚ approximately 50 A2 In UMPK from P furiosus, this loop is responsible for binding the adenine base of an ATP analogue (Protein Data Bank accession number FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6405 UMP kinase from Ureaplasma parvum L Egeblad-Welin et al 2BRI), and, as no ATP ⁄ ATP analogue is bound to the enzyme, the loop is not held in a tight position The forces that hold the hexamer together are (a) hydrophobic interactions between the dimeric couples (A + B, C + D and E + F), (b) a few hydrogen bonds, and a hydrophobic interaction between A + C, B + E and D + F, and (c) electrostatic forces in the central channel of the hexamer between B, C and F, and A, D and E The hydrophobic interactions between A and B (Fig 3A,B) are formed between the antiparallel a3-helices from each subunit, primarily by Leu, Met and Ile One hydrogen bond could be identified at each end of the interacting a-helices between Asn86 and the carbonyl carbon of Leu62 Between A and C, the a7 from each subunit is connected via two hydrogen bonds between Thr197 and Glu204 (Fig 3A,C), and a hydrophobic interaction between Thr131 and Phe133 (Fig 3D) The central channel of the hexamer is made up of two layers of electrostatic forces on top of each other, with one layer rotated by 60° The amino acids found in the electrostatic hole in each layer are Lys102 and Asp104 Lys102 is held in position by Asp104, and, in the interaction between A, D and E, a water molecule is hydrogen-bonded to the three lysines (Fig 3E) There is no water molecule fixing the three lysines from the B, C and F subunits, and there is no direct interaction between subunits A and F, B and D, or C and E A phosphate ion was found in the donor site of all subunits (Fig 2B), although the protein was crystallized in the presence of mm GTP The B factors for the phosphate ions in the subunits varied from 46– ˚ 55 A2 Structural alignments with UMPK from E coli (Protein Data Bank accession numbers 2BND and 2BNF) indicated that the phosphate ion in UpUMPK was bound in the position corresponding to the b-phosphate of either UDP or UTP Combinations of co-crystallization and soaking were performed in order to bind either substrate or inhibitor However, in all collected data sets (UpUMPK co-crystallized with UMP, and UTP or with no added ligand), a phosphate ion was detected in the active site This indicates that phosphate ions were bound to the enzyme during expression and purification, since no phosphate buffers were used during the preparation procedures As no structural data for UpUMPK with UMP bound were obtained, the binding of UMP to the active site was modeled by structural alignment with UMPK from E coli with UMP bound [6], which gave ˚ an rmsd of 1.29 A for 212 Ca-atoms The binding of UMP in E coli creates a tightly closed conformation with a2 (Fig 4A) In UpUMPK, this a-helix has a 6406 more open conformation in the absence of UMP (Fig 4A) The amino acid residues responsible for binding of UMP are relatively conserved (Fig 4B); the only difference is a Phe133 found in the position corresponding to Asn140 in E coli The probable binding motif for the uracil base is through hydrogen bonds from N3 to the backbone O of Phe133, and from O4 to the backbone N and the side chain of Thr131, with the ribose moiety anchored by two hydrogen bonds, one from 2¢-OH to the side chain of Asp70, and one from the backbone N of Gly63, and the phosphate group forming hydrogen bonds from O1 to Arg55, from O2 to the backbone N and the side chain of Thr138, and from O3 to the backbone N of Gly50 A P-loop (GXXXXGKS ⁄ T) that is usually found in nucleotide binding enzymes is not present in UpUMPK [19] UpUMPK contains instead a glycine-rich motif within amino acids 44–54 that is responsible for binding of the phosphate ion These amino acids are relatively conserved among the UMPKs, with an amino acid sequence motif as follows: V ⁄ IXV ⁄ IXGGGXXXR (Fig 1) Functional characterization The substrate specificity of purified recombinant UpUMPK was explored using a coupled spectrophotometric assay [20], and several ribonucleoside monophoshates and deoxyribonucleoside monophosphates were tested as phosphate acceptors with ATP as phosphate donor The only effective acceptor was found to be UMP, and the pH optimum of the reaction was 6.8 It was also observed that a stoichiometry between Mg2+ and ATP of : gave 1.6-fold higher catalytic rates compared to a : stoichiometry (data not shown) Therefore, the Mg2+:ATP ratio was kept at : in all further experiments, in analogy with other UMPK studies [14,17] Two-substrate kinetics with UMP and ATP Initial two-substrate kinetic assays were performed with varying UMP concentrations (100–2000 lm) and various fixed ATP concentrations (100, 200, 500 and 1000 lm), and the dependency of the velocity on substrate concentration was hyperbolic for UMP as the varied substrate (Fig 5A) We then calculated what should be the true Km and Vmax values for UMP, giving 214 ± lm and 262 ± 24 lmolỈmin)1Ỉmg)1, respectively However, with ATP as the variable substrate, the kinetic curves showed a detectable deviation from Michaelis–Menten kinetics, especially at low substrate FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS L Egeblad-Welin et al UMP kinase from Ureaplasma parvum A B C A B B A C D E204 A T197 A T131 F133 C C T197 F133 T131 E204 E K102 E D104 D104 K102 K102 D104 A D Fig (A) Interactions between subunits A, B and C (B) Hydrophobic interaction between the a4 helices from A and B (C) Interaction between a7 helices from A and C Hydrogen bonds form between Thr197 and Glu204 (D) Hydrophobic interaction between A and C, formed by Thr131 and Phe133 (also referred to as the cross-talk region) (E) Electrostatic interactions in the central channel of the enzyme between subunits A, D and E Asp104 holds Lys102 in position in each subunit A water molecule is fixed by the three lysines from each subunit concentrations (Fig 5B) The best fit was therefore to the Hill equation, giving an n value of 1.54 ± 0.10, demonstrating positive cooperativity with ATP With mm UMP, the K0.5,app(ATP) was 316 ± 54 lm and the Vmax,app(ATP) was 172 ± 23 lmolỈmin)1Ỉmg)1, which is similar to the values calculated in the initial kinetic analysis UTP as end-product inhibitor The nature of UTP inhibition was investigated in assays with fixed ATP (1 mm) and variable UMP concentrations (50–1000 lm) Double-reciprocal plots at various UTP concentrations demonstrated that UTP was a competitive inhibitor towards UMP, with a Ki FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6407 UMP kinase from Ureaplasma parvum L Egeblad-Welin et al A A B D77 B F133 G63 G56 D70 G57 G50 N140 R55 R62 T131 T138 T145 T138 Fig (A) Superposition of UpUMPK (green) on top of E coli UMPK (blue) at the active site (B) Binding of UMP to E coli UMPK and the location of amino acid residues in UpUMPK based on the superposition value of 0.7 mm (Fig 6A) When ATP was the variable (50–1000 lm) substrate at a fixed UMP concentration (1 mm), the inhibition by UTP affected primarily the Vmax values, while the K0.5 ⁄ Km values at various UTP concentrations were in the same range Thus, UTP inhibition was noncompetitive towards ATP, with a Ki value of 1.2 mm (Fig 6B) When this data set was fitted to the Hill equation, the n values were 1.4, 0.98 and 1.0 for UTP at 0, 0.5 and 1.0 mm, respectively, which indicates that the positive cooperativity behavior with ATP is altered by the presence of UTP Determination of enzyme-bound orthophosphate and inhibition of enzyme activity by orthophosphate In the UpUMPK structure, a phosphate ion was found in the active site, and this raised a question concerning the actual orthophosphate content in the enzyme used in the functional studies Therefore, the phosphate 6408 C Fig (A) Activity versus [UMP] at various concentrations of ATP (lM) (B) Activity versus [ATP] at various concentrations of UMP (lM) (C) Lineweaver–Burk plot of ⁄ v against ⁄ [UMP] at various concentrations of ATP (lM) content in the enzyme preparation was determined using a colorimetric method A concentrated enzyme solution was precipitated with 5% perchloric acid at low temperature to release bound phosphate ions The concentration of free phosphate in the supernatant was 3.52 lm, and the total concentration of enzyme was FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS L Egeblad-Welin et al UMP kinase from Ureaplasma parvum 200 A v (µmol/min/mg) 150 100 50 0 1000 2000 3000 4000 5000 6000 [Pi] µM Fig Inhibition [ATP] ¼ mM of UpUMPK activity by Pi [UMP] and B A A T138 N140 N140 T138 C Fig (A) UTP acts as a competitive inhibitor towards UMP Double-reciprocal plot of ⁄ v versus ⁄ [UMP] at 0, 0.1 and 0.5 mM UTP (B) UTP acts as a noncompetitive inhibitor towards ATP Activity versus [UMP] at 0, 0.5 and mM UTP 91.12 lm, giving a molar ratio of UpUMPK ⁄ phosphate of 25 ⁄ The effect of orthophosphate on enzyme activity was examined It was shown that phosphate inhibited UpUMPK activity with an IC50 value of mm (Fig 7) Functional consequences of F133N and F133A mutations GTP is an activator for all bacterial UMPKs studied to date [5,14–17], and it was therefore tested with UpUMPK In an assay with mm UMP and ATP, the addition of 0.5 or mm GTP resulted in no detectable change in UpUMPK activity In order to find an explanation for the lack of GTP activation, the UpUMPK structure was compared to that of E coli UMPK In E coli UMPK, residue Asn140 forms a hydrogen bond to Thr138 of a neighboring subunit (Fig 8) The backbone of Asn140 and Fig Cross-talk region of E coli UMPK between subunits A and C, with UMP bound to the active site Amino acid residues T138 and N140 are found in the cross-talk region (Protein Data Bank accession number 2BNE) [6] the side chain of Thr138 also form hydrogen bonds to the uracil base Mutations of either Thr138 or Asn140 to Ala abolished GTP activation, indicating that these residues are involved in GTP activation of the E coli UMPK [6] In UpUMPK, a region between subunits A and C had a Phe133 in the position corresponding to Asn140 in the cross-talk region of E coli UMPK Phe133 is not able to form hydrogen bonds due to its hydrophobic interactions with Thr131 (Fig 3D) To mimic E coli UMPK, Phe133 of UpUMPK was mutated to Asn or Ala The mutant enzymes, F133N and F133A, were expressed, purified and characterized With mm UMP and ATP as substrates, the activities of F133N and F133A were only 50 and 20% of that of the wild-type enzyme Similar to the situation with wild-type UpUMPK, addition of 0.5 and mm GTP resulted in no detectable activation of F133N or F133A mutant enzymes FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6409 UMP kinase from Ureaplasma parvum L Egeblad-Welin et al 60 50 F133N V/(u/mg) 40 30 F133A 20 10 0 200 400 600 [UMP]/µM 800 1000 1200 Fig Substrate saturation curves of UpUMPK mutant enzymes: F133N and F133A with UMP as variable substrate With variable UMP concentration and fixed ATP concentration, both the F133N and F133A mutants displayed negative cooperativity, and the Hill coefficients were 0.65 ± 0.05 and 0.85 ± 0.05, respectively (Fig 9) At mm ATP, the K0.5,app(UMP) and Vmax,app values for F133N were 1100 ± 150 lm and 107 ± 15 lmolỈ min)1Ỉmg)1, respectively For F133A, the K0.5,app(UMP) and Vmax,app values were 896 ± 212 lm and 63 ± lmolỈmin)1Ỉmg)1, respectively The K0.5,app (UMP) values for the mutant enzymes were four- to fivefold higher than that of the wild-type enzyme The Vmax,app values were also affected; they were twofold lower in case of F133N, and approximately fourfold lower for the F133A mutant Discussion In this study, we have investigated UpUMPK and shown that the structure resembles UMPKs from bacteria and archaea belonging to the amino acid kinase family A phosphate ion was bound to all subunits in the enzyme However, the molar content of orthophosphate in the soluble UMPK was only 4% The concentration of phosphate giving 50% inhibition of enzyme activity (IC50 value) was mm, indicating that the phosphate did not have a very high affinity for the enzyme The discrepancy between the structural and functional results is not easily explained and may be methodological At present, we cannot distinguish the possibilities that the enzyme contains tightly bound phosphate ions that cannot be released by acid precipitation, or alternatively that only the phosphate-binding fraction of the enzyme can form crystals The Km value for UpUMPK with UMP is high (214 ± lm) compared to the Km values for other UMPKs, e.g S solfataricus, 14 lm; E coli, 43 lm (at 6410 pH 7.4); B subtilis, 30 lm; St pneumoniae, 100 lm [8,14–16] A possible reason for the high Km value for UpUMPK with UMP could be the presence of a phosphate ion in the active site However, as discussed above, the kinetic results most likely reflect the properties of the native fully active UpUMPK enzyme Positive cooperativity with ATP was observed when the assays were performed with ATP as the variable substrate (n value of 1.5) However, in the inhibition experiment with UTP, the n values were close to 1.0, indicating that the presence of UTP abolished the positive cooperativity observed with ATP alone At present, there is no clearcut explanation for this observation Nevertheless, the cooperative behavior of UpUMPK with varied ATP concentrations is less pronounced than that reported with other Gram-positive bacterial UMPKs (n values of 1.9–2.5 with mm UMP) [14,17] The fact that UTP is a competitive inhibitor for UMP is in agreement with the structural data from E coli UMPK, where it has been shown that UTP binds to the base moiety in the active site [6] For S solfataricus, the same pattern was observed with UTP and UMP, but in that case UTP is a competitive inhibitor towards ATP [8] The Ki values for UTP versus UMP (0.7 mm) and ATP (1.2 mm) are high, and may indicate that UTP is an inefficient inhibitor in vivo UMPKs from E coli, Salmonella typhimurium, H influenzae, Neisseria meningitidis, B subtilis, St pneumoniae, Staphylococcus aureus and Enterococcus faecalis were all activated by GTP by a factor of 2.5–18.5 [17] The UMPK from the archaea S solfataricus was the first UMPK for which lack of activation by GTP was shown [8], and in this study we have shown that UMPK from U parvum also lacks activation by GTP The mutational study of residue F133 was performed to clarify whether this residue is involved in GTP activation F133 was mutated to Asn in an attempt to create a GTP-activated enzyme, and F133A was prepared and tested as a control Neither of the UpUMPK mutants F133N and F133A were activated by GTP Thus, this residue alone is not responsible for GTP activation However, an interesting feature was observed UpUMPK F133N exhibited negative cooperativity with UMP as a substrate (n value of 0.65), and the same was true of UpUMPK F133A to a lesser extent (n value of 0.85) This is the first time that negative cooperativity has been described with a bacterial UMPK The observed negative cooperativity may be explained by alteration of the geometry of the active site in the neighboring subunit when UMP binds to the enzyme, i.e mutation of residue F133, which is FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS L Egeblad-Welin et al located in the interface of two subunits, may have affected the mode of subunit interaction Jensen et al (2007) have compared the sequence and structure of S solfataricus UMPK to those of the known bacterial UMPKs A loop between a6 and a7 was only present in archaea, and was referred to as the archaea-specific loop (Fig 1) Another difference that was detected was in the loop between a3 and a4, which was absent in archaea, and is therefore referred to as the bacteria-specific loop (Fig 1) Jensen et al (2007) suggested that either the amino acid residues found in the bacteria-specific loop or the lack of a known nucleotide binding motif GXXGXG [21] in the N-terminus was responsible for the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As UpUMPK has essentially the same fold as E coli UMPK, it is unlikely that residues in the bacteria-specific loop are involved in the activation However, the N-terminal GXXGXG motif is not found in UpUMPK, suggesting that this motif may be involved in GTP activation UMPK is involved in both de novo and salvage synthesis of DNA and RNA precursors The results presented here suggest that UpUMPK is an enzyme that is mainly regulated by the UMP and orthophosphate levels, and is not very sensitive to feedback inhibition by the end-product UTP Furthermore, there is no evidence for allosteric activation by GTP, although the overall structure is highly similar to the other bacterial UMPKs The relative simplicity of the apparent regulation of this structurally complex enzyme may be due to its lifestyle, as it grows in the urinary tract where the salvage of uridine and uracil may serve as a rich source for UMP biosynthesis One of the goals of this investigation was to evaluate whether UpUMPK is a promising new target for development of antibacterial agents Bacterial UMPKs have no sequence or structural homology to the human enzyme CMP–UMPK, which makes them potential targets for drug development, but, in the case of UpUMPK, a search for non-nucleoside ⁄ nucleotide inhibitors may be more successful Experimental procedures Site-directed mutagenesis The expression plasmid pET-14b-UpUMPK has been described previously by Wang [4] The mutants UpUMPKF133N and UpUMPK-F133A were constructed by sitedirected mutagenesis using the plasmid pET-14b containing cDNA for UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and underlined The F133A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F133A-rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) The mutations were verified by DNA sequencing using the BigDye terminator cycle sequencing kit and the ABI PRISM 310 genetic analyzer (PE Applied Biosystems, Foster City, CA, USA) Expression and purification of recombinant enzymes Both wild-type UpUMPK and the mutant enzymes were expressed in E coli BL21 (DE3) in Luria–Bertani (LB) medium The enzymes were overexpressed by induction with isopropyl-b-d-thiogalactoside (0.16 mm) overnight at 37 °C, and bacteria were harvested by centrifugation at 4600 · g for 15 at °C The pellet was resuspended in buffer A, containing 50 mm Tris ⁄ HCl (pH 7.5), 0.2 m KCl, mm MgCl2 and 0.2 mm phenylmethylsulfonyl fluoride The cells were then disrupted by sonication for with s pulses, and thereafter centrifuged for 30 at 4600 · g at °C Purification was carried out at °C The supernatant was applied to a metal affinity column (TALON resin, BD Biosciences Clontech, Palo Alto, CA, USA) using the gravity flow procedure The column was washed first with buffer B, containing 20 mm Tris ⁄ HCl (pH 7.5) and 0.2 m KCl, and then with buffer B and 20 mm imidazole The protein was eluted with buffer B and 250 mm imidazole The purity of the protein was analyzed by SDS ⁄ PAGE [22], and the protein concentration was determined according to the method described by Bradford [23], with BSA as the standard protein For wild-type UpUMPK, approximately 110 mg pure protein was obtained from a L culture Crystallization The UMPK contained an N-terminal His-tag with the sequence MGSSHHHHHHSSGLVPRGSHM Crystals were grown by vapor diffusion, under conditions of 0.2 m ammonium fluoride and 20% (w ⁄ v) poly(ethylene glycol) 3350 at 15 °C The enzyme concentration was 1.8 mgỈmL)1, and mm GTP was added to the protein The protein and crystallization solution were mixed equally (2 lL of each) in a hanging drop Data collection The crystals were flash-frozen in liquid nitrogen, using mother solution with the addition of 15% (v ⁄ v) poly(ethylene FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6411 UMP kinase from Ureaplasma parvum L Egeblad-Welin et al glycol) 400 as cryoprotectant, and data were collected at ID14-eh4 at the European synchotron radiation facility (ESRF), Grenoble, France The data were indexed, scaled and merged using mosflm [24] and scala [25], and the crystals were found to belong to the space group P21 with a solvent content of 48% The content of the asymmetric unit was six monomers Structure determination and refinement The structure was solved by molecular replacement using molrep [26], with the monomer of UMPK from H influenzae (Protein Data Bank accession number 2A1F) as the search model Simulated annealing was performed in cns [27], and further refinement was performed in refmac5 [28], during which noncrystallographic symmetry (NCS) restraints were applied to residues 5–160 and 193–230 with tight main-chain and medium side-chain restraints Model building was carried out in o [29] and coot [30] In chain A, residues and 169–176 are missing; in chain B, residues 167–172 are missing; in chain C, residues 1, and 169–174are missing; in chain D, residues 168–174 are missing; in chain F, residues and 168–175 are missing All amino acid residues were present in the E chain, and part of the His-tag was observed in the B chain A few amino acid residues are found in disallowed regions in the Ramachandran plot; these are A4, A165, A167, B3, B4 and F165, all of which are found at either the beginning or the end of a chain The structure has been deposited to Protein Data Bank under the accession number 2va1 All figures were created using pymol [31], and sequence alignments were created using clustalw [32] and espript [33] Determination of enzyme-bound orthophosphate The presence of orthophosphate in UpUMPK was determined by a colorimetric method [34] Briefly, the buffer used for UpUMPK preparation was exchanged with water using a PD-10 column (GE Healthcare, Uppsala, Sweden), and then the protein concentration was determined To mL UpUMPK solution, perchloric acid was added to a final concentration of 5%, and the mixture was incubated on ice for 10 The mixture was then centrifuged at 16 000 · g for 15 at °C to remove precipitated protein The supernatant was neutralized with KOH, and incubated on ice for 15 After centrifugation at 16 000 g for 20 at °C, the supernatant was used in the colorimetric assay as described previously [34] The concentration of orthophosphate was 3.52 lm, and the UpUMPK concentration was 91.12 lm Enzyme assays The UMPK activity was determined using a coupled spectrophotometric assay [20] with a Cary spectrophotometer 6412 (Varian Techtron, Mulgrave, Australia) at 37 °C The reaction medium (final volume mL) contained 50 mm Tris ⁄ HCl pH 6.8, mm dithiothreitol, 0.5 mg mL)1 BSA, mm phosphoenolpyruvate, 0.3 mm NADH and lmolỈ min)1Ỉmg)1ỈmL)1 of pyruvate kinase and lactate dehydrogenase Nucleoside diphosphate kinase (NDPK) was not added, as this did not lead to a significant change in the rates determined, as observed by Fassy et al [14], and avoids the complication of potential UTP formation The coupling enzymes (pyruvate kinase and lactate dehydrogenase) were tested with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and ATP (100, 200, 500 and 1000 lm) In the GTP-activation experiments, the concentrations of UMP and ATP were kept at mm In all experiments, MgCl2 concentration was kept in a stoichiometry of : towards NTP The enzyme concentration was 0.5 lg per assay for the wild-type and UpUMPK-F133N, and lg per assay for UpUMPK-F133A The decrease in [NADH] was monitored at 340 nm Analysis of kinetic data Kinetic data were evaluated by nonlinear regression analysis using either the Michaelis–Menten equation v ¼ VmaxỈ[S] ⁄ (Km + [S]), or the Hill equation v ẳ Vmaxặ[S]n (K n + [S]n), where Km is the Michaelis constant, K0.5 is 0:5 the value of the substrate concentration [S] where v ¼ 0.5 Vmax, and n is the Hill coefficient If n ¼ 1, there is no cooperativity, if n < there is negative cooperativity, and if n > there is positive cooperativity One unit corresponds to lmol min)1 The inhibition studies were analyzed using equations for competitive and noncompetitive inhibitors For competitive inhibition, the equation is v ẳ Vmaxặ[S] (Km(1 + [I] ⁄ Ki) + [S]), and for noncompetitive inhibition the equation is v ẳ Vmaxặ[S] (Km + [S])(1 + [I] ⁄ Ki) Ki for UTP towards ATP was determined using the secondary plot of slope versus [UTP] Acknowledgements The authors wish to thank Andrea Hinas and Fredrik Soderbom (Department of Molecular Biology, Swedish ă University of Agricultural Science) for help with mutagenesis, Hans Eklund (Department of Molecular Biology, Swedish University of Agricultural Science) for help with the structure determination, and Mark Harris (Department of Molecular Biology, Uppsala University) for proof reading This work was supported by grants from the Swedish Research Council and the FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS L Egeblad-Welin et al UMP kinase from Ureaplasma parvum Swedish Research Council for the Environment, Agricultural Sciences, and Spatial Planning (FORMAS) References Pollack JD (2001) Ureaplasma parvum: an opportunity for combinatorial genomics TRENDS Microbiol 9, 169–175 Volgmann T, Ohlinger R & Panzig B (2005) Ureaplasma parvum – harmless commensal or underestimated enemy of human reproduction? A review Arch Gynecol Obstet 373, 133–139 Glass JI, Lefkowitz EJ, Glass JS, Heiner CR, Chen EY & Cassell GH (2000) The complete sequence of the mucosal pathogen Ureaplasma parvum Nature 407, 757–762 Wang L (2007) The role of nucleoside monophosphate kinases in the synthesis of nucleoside triphosphates FEBS J 274, 1983–1990 Serina L, Blondin C, Krin E, Sismeiro O, Danchin A, Sakamato H, Gilles A-M & Barzu O (1995) Escherichia ˆ coli UMP-kinase, a member of the aspartokinase family, is a hexamer regulated by guanine nucleotides and UTP Biochemistry 34, 5066–5074 Briozzo P, Evrin C, Meyer P, Assairi L, Joly N, Barzu ˆ O & Gilles A-M (2005) Structure of Escherichia coli UMP kinase differs from that of other NMP kinases and sheds new light on enzyme regulation J Biol Chem 280, 25533–25540 Marco-Marı´ n C, Gil-Ortiz F & Rubio V (2005) The crystal structure of Pyrococcus furiosus UMP kinase provides insight into catalysis and regulation in microbial nucleotide biosynthesis J Mol Biol 352, 438–454 Jensen KS, Johansson E & Jensen KF (2007) Structural and enzymatic investigation of the Sulfolobus solfataricus uridylate kinase shows competitive UTP inhibition and lack of GTP stimulation Biochemistry 46, 2745– 2757 Yan H & Tsai MD (1999) Nucleoside monophosphate kinases: structure, mechanism, and substrate specificity Adv Enzymol Relat Areas Mol Biol 73, 103–134 10 Hutchison CA III, Peterson SN, Gill SR, Cline RT, White O, Fraser CM, Smith HO & Venter JC (1999) Global transposon mutagenesis and a minimal mycoplasma genome Science 286, 2165–2169 11 Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison CA III, Smith HO & Venter JC (2006) Essential genes of a minimal bacterium Proc Natl Acad Sci USA 103, 425–430 12 Yamanaka K, Ogura T, Niki H & Hiraga S (1992) Identification and characterization of the smbA gene, a suppressor of the mukB null mutant of Escherichia coli J Bacteriol 174, 7517–7526 13 Akerley BJ, Rubin EJ, Novick VL, Amaya K, Judson N & Mekalanos JJ (2002) A genome-scale analysis for 14 15 16 17 18 19 20 21 22 23 24 25 26 27 identification of genes required for growth or survival of Haemophilus influenzae Proc Natl Acad Sci USA 99, 966–971 Fassy F, Krebs O, Lowinski M, Ferrari P, Winter J, Collard-Dutilleul V & Salahbey Hocini K (2004) UMP kinase from Streptococcus pneumoniae: evidence for co-operative ATP binding and allosteric regulation Biochem J 384, 619–627 Serina L, Bucurenci N, Gilles A-M, Surewicz WK, Fabian H, Mantsch HH, Takahashi M, Petrescu I, Batelier G & Barzu O (1996) Structural properties of ˆ UMP-kinase from Escherichia coli by pH and UTP Biochemistry 35, 7003–7011 Gagyi C, Bucurenci N, Sıˆ rbu O, Labesse G, Ionescu M, Ofiteru A, Assairi L, Landais S, Danchin A, Barzu O & ˆ Gilles A-M (2003) UMP kinase from the gram-positive bacterium Bacillus subtilis is strongly dependent on GTP for optimal activity Eur J Biochem 270, 3196– 3204 Evrin C, Straut M, Slavova-Azmanova N, Bucurenci N, Onu A, Assairi L, Ionescu M, Palibroda N, Barzu O & ˆ Giles AM (2007) Regulatory mechanisms differ in UMP kinases from gram-negative and gram-positive bacteria J Biol Chem 282, 7242–7253 Bucurenci N, Serina L, Zaharia C, Landais S, Danchin A & Barzu O (1998) Mutational analysis of UMP ˆ kinase from Escherichia coli J Bacteriol 180, 473–477 Saraste M, Sibbald PR & Wittinghofer A (1990) The P-loop – a common motif in ATP- and GTP-binding proteins Trends Biochem Sci 15, 430–434 Blondin C, Serina L, Wiesmuller L, Gilles A-M & ¨ Barzu O (1994) Improved spectrophotometric assay of ˆ nucleoside monophosphate kinase activity using the pyruvate kinase ⁄ lactate dehydrogenase coupling system Anal Biochem 220, 219–221 Schulz GE (1992) Binding of nucleotides by proteins Curr Opin Struct Biol 2, 61–67 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head bacteriophage T4 Nature 227, 680–685 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding Anal Biochem 72, 248–254 Leslie AGW (1992) Joint CCP4 + ESF-EAMCB Newsletters on Protein Crystallography, no.26 Collaborative Computational Project Number (1994) The CCP4 suite: programs for protein crystallography Acta Crystallogr D 50, 760–763 Vagin A & Teplyakov A (2000) An approach to multicopy search in molecular replacement Acta Crystallgr D 56, 1622–1624 Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J, Nilges M, Pannu NS, et al (1998) Crystallography & NMR FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS 6413 UMP kinase from Ureaplasma parvum L Egeblad-Welin et al system: a new software suite for macromolecular structure determination Acta Crystallogr D 54, 905–921 28 Murshudov GN, Vagin AA & Dodson EJ (1997) Refinement of macromolecular structures by the maximum-likelihood method Acta Crystallogr D 53, 240– 255 29 Jones TA, Zou JY, Cowan SW & Kjeldgaard M (1991) Improved methods for building protein models in electron density maps and the location of errors in these models Acta Crystallogr A 47, 110–119 30 Emsley P & Cowtan K (2004) Coot: model building tools for molecular graphics Acta Crystallogr D 60, 2126–2132 6414 31 DeLano WL (2002) The PyMOL User’s Manual DeLano Scientific, San Carlos, CA, USA 32 Chenna R, Sugawara H, Koike T, Lopez R, Gibson T, Higgins DG & Thompsen JD (2003) Multiple sequence alignment with the Clustal series of programs Nucleic Acids Res 31, 2497–3500 33 Gouet P, Courcelle E, Stuart DI & Metoz F (1999) ESPript: multiple sequence alignments in PostScript Bioinformatics 15, 305–308 34 Gonzalez-Romo P, Sanchez-Nieto S & Gavilanes-Ruiz M (1992) A modified colorimetric method for determination of orthophosphate in the presence of high ATP concentrations Anal Biochem 200, 235–238 FEBS Journal 274 (2007) 6403–6414 ª 2007 The Authors Journal compilation ª 2007 FEBS ... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and ATP... et al UMP kinase from Ureaplasma parvum Swedish Research Council for the Environment, Agricultural Sciences, and Spatial Planning (FORMAS) References Pollack JD (2001) Ureaplasma parvum: an opportunity