... 2001) The mutation responsible for familial adenomatous polyposis is associated with antral adenocarcinoma in Japanese and Korean populations 1.5 Clinical Management and Clinical Outcomes of Gastric ... long preclinical phase provides adequate time for clinical intervention There is data to support the idea thata long clinical phase is associated with a long preclinical phase and verse versa ... have started clinical applications in recent years (Wang et al 2012) For advanced GC cases, systemic medical management remains the mainstay Besides traditional chemotherapy, various immunotherapeutic...
... implemented in AnGiang, DongThap and LongAn, almost the farmers said that “Living with flood” or “Shaking hands with flood” as the best way forthe Mekong Delta sustainable development IV DISCUSSION In ... forecast the relation between the warm atmosphere and the storms inthe tropical monsoon Asia Survey and forecast the effects of the dams and irrigation systems in upstream to the low parts of the basin ... such as pumping stations, irrigation and drainage canal systems, crop protection dikes and dams have been built inthe Mekong Delta Almost these water works were investigated by the national budget...
... defor- estation In addition to payments for forest carbon, other payments for reductions in deforestation and unsustainable land use are emerging Achieving sustainable land ... climate change and forest own policies for maintaining their natural capital These state-level initiatives provide lessons and models upon which national and international ... Guarantees Guarantors insure against default of a bond (or other debt payback) for any reason +++ +++ +++ Commercial Insurance Insure against losses due to specific risk events, such as natural...
... was used to manage and analyze the data First, missing values were handled according to the guidelines given inthe manual of the KIDSCREEN-52 The percentage of missing data was
... all of the generated data inthenetwork and permits the performing of certain data optimizations (e.g., data aggregation) before sending the data to the destination sink [6] Second, in WSNs ... cell In RailRoad and LBDD, the rendezvous region is divided into smaller subregions called station All the nodes ina station are informed about the data but one of them forwards data towards sink ... the sink using GF Using a line as rendezvous area at the middle of thenetwork can results in high latency forthe nodes near the boundary of thenetwork RailRoad [12] places avirtual rail in...
... acknowledge the Australian Podiatry Education and Research Foundation fora research grant that assisted this project – the funding body had no input into the design; inthe collection, analysis, and interpretation ... interpretation of data; inthe writing of the manuscript; and inthe decision to submit the manuscript for publication We also gratefully acknowledge the surgeons that participated in data collection ... et al 1977 Stage Lateral displacement of the great toe (hallux) at the metatarsophalangeal joint Minimal sesamoid displacement Stage Hallux abductus deformity (great toe pressing against the...
... many domains in common A GTP binding domain (Domain I) is present in all factors, while TypA, LepA and EF-G share an additional three domains (Domains II, III and V) [39,40] EF-G contains a unique ... LepA and TypA share a similar arrangement of functional domains, especially the latter three, which share domains I, II, III and V and each also contains a unique domain (Figure 4A) Crystal structures ... facilitate different roles in translation Inthe case of SVR3/AtcpTypA, the C-terminal domain may play a crucial role in mediating specific interactions between TypA and the ribosome at chilling...
... ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg), with capitals indicating ERS1 sequence and parentheses indicating T-DNA left border sequence This mutation was named ers1-3 to differentiate it ... insertion, and ETR1-3'F (5' CATACCGAAAGTTCCAGCCATTC 3') and ETR1-3'R (5' CAAGCATCCATAACTCGATCCAAATTC 3') for amplification of a product 3' to the site of the T-DNA insertion After 25 cycles, the ... from the Arabidopsis Knockout Facility [20] A line was identified that contained a T-DNA insertion within the first exon of ERS1 (Fig 1A) Sequence at the T-DNA junction with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg),...
... cluster After calculating the BP annotation ratios for all clusters, we treat the mean value of all annotation ratios as the final BP annotation ratio We also define the CC and MF annotation ratios ... comparative analyses onthe functional annotation ratios of the three algorithms have demonstrated thatthe genes ineach cluster obtained using the WDCM show not only the similar expression patterns, ... cancer and follicular lymphoma data sets The detailed comparisons forthe lung cancer data set are given in Figure 4A, from which we found thatthe three final functional annotation ratios of the...
... Increased sTREM-1 levels could also be explained by bacterial contamination or infection (that is, aspiration on scene) We therefore excluded the BALs of patients positive for intracellular organisms, ... tissue macrophages [9] The resulting self-propagating inflammation within the alveolar space might cause devastating lung injury and is associated with a significant mortality Given the role ... sTREM-1 as a biological marker for an inflammatory response within the lung, we pursued the hypothesis thatthe inflammation induced by severe trauma might lead to the expression of sTREM-1 within...
... ( Aa ) d j − prijk ( aa ) g j ⎤ ⎦ where pr ijk (AA), pr ijk (Aa) and pr ijk (aa) are the probabilities of the genotypes AA, Aa and aa forthe combination of the ith and jth individual and the ... Spain 2Facultad de Veterinaria, Universidad de Zaragoza, 50013 Zaragoza, Spain Authors’ contributions LV wrote the main computer programs and ran them Both authors wrote and approved the final ... is the number of SNP and x ij are indicator functions that take the values 1, 0, -1 forthe SNP genotypes AA, Aa and aa at each loci, respectively The assumed distributions foreach additive a...
... the contrary, instead), subtractive (apart from that, except for that) , and alternative (alternatively) Halliday (1994) also states thatin enhancement, one clause enhances the meaning of another ... fundamental functions of language into three broad metafunctions: ideational, interpersonal and textual Each functional component corresponds to each parameter register as the working hypothesis: ... information ina text, and is concerned with clauses as messages The textual metafunction acts to organize the flow of interpersonal and ideational meanings as they unfold ina text The textual...
... Linguistics.Wellington: Continuum Wellington House Halliday, M .A. K (1994) An Introduction to Functional Grammar Second Edition, London: Edward Arnold Halliday, M .A. K & Hasan, R (1985) Language, Context and ... the description of the main areas of functional grammar and the latter deals with the analysis of the text for discussion 1.5 Data collection The text is taken from one of the most famous short ... related to 1) Interpersonal meanings, which focus onthe social function of language, more specifically, the participants; 2) Ideational meanings, focusing on how language is used, that is, the...
... of “make shift measures” to urinate • Dehydration (not drinking fluids to prevent urination) Vaginal symptoms: Itching, burning, pain, & discharge Menstrual complaints: Pain, heavy bleeding, ... recognize the impact of the deployed environment on feminine health and hygiene Preventive measures to avoid vaginal infections, urinary tract i f i infections, (UTIs) and menstrual symptoms are not ... Does providing women with information on feminine • hygiene and menstrual self-care practices lead to a decrease in genitourinary complaints during deployment? Specific Aims To increase knowledge...
... in Asia and the Pacific is increasingly concentrated inthe places with harsh living conditions, including marginal land, depleted resources, pollution, congestion, and proneness to natural and ... ADB assumes thatin certain rural locations, the primary reason for an inability to escape poverty has to with the natural environment For example, assessments of the poor living in dryland areas ... areas may conclude thatthe main reasons for their persistent poverty are marginal land and a lack of access to water This does not mean unawareing thatthe poverty has multiple causes, often including...
... that gathers information about the software, hardware and status of themachine it is running onThe server polls the Sentinels, gathers network information from them, and then represents that ... indicates it is a specialization of ConceptualWork, the collection of deliberately created things that lack a location in space but have a beginning in time and an associated abstract information ... that information inthe KB 2.3 CycSecure Software Components CycSecure Sentinels and Server The Sentinels are small software daemons that run oneachmachineonthe target network They are designed...
... cluding political debates, business meetings, and online chats More formally, such datasets contain C conversations A conversation c has Tc turns, each of which is a maximal uninterrupted utterance ... not appear inthe corresponding question This results ina set of non-binary reference segmentations For evaluation metrics that require binary segmentations, we create a binary segmentation by ... probability thatthe speaker m will change the topic (distribution) of a conversation We take a Bayesian nonparametric approach (M¨ ller and Quintana, 2004) Unlike u 2.1 Note the distinction with phonetic...