c 2 chemical characterization of the backbone using the sulfonation of toluene with gaseous so 3
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc 936 ccacacctgatgaccccactcctggctgtacccctctcccgctcagctcacccccccgcaggggctgctgac ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (24 5) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 28 8 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 36 0 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 4 32 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA...
- 11
- 527
- 0
Báo cáo hóa học: " Chemical characterization of extra layers at the interfaces in MOCVD InGaP/GaAs junctions by electron beam methods" ppt
... areas of the TEM specimen, the kinematical approximation is used, according to which the (20 0) DF intensity I200 is proportional to F200 , with F200 as the structure factor of the (20 0) diffraction ... remaining in the MOCVD chamber in contact with the sample surface after the PH flux has been switched off This is because the chemical bond strength of Ga-P is greater than that of Ga-As [22 ], which results ... CW, Yen CH, Liu WC: ’A Study of Composite-Passivation of an InGaP/GaAs Heterojunction Bipolar Transistor’ J Electrochem Soc 20 06, 1 53: G 938 Wang CK, Yu KH, Chiou WH, Chen CY, Chuang HM, Liu WC:...
- 7
- 387
- 0
Báo cáo hóa học: " Modeling and Characterization of VCOs with MOS Varactors for RF Transceivers" doc
... predict the tuning curve of the LC VCOs The shape of the tuning curve and the effective varactor capacitance were shown to depend on the losses of the tank and the magnitude of the tail current The ... associated with the series capacitance of the gate oxide and the depletion region under the gate C f models the fringing capacitance related to the sidewalls of the gate Lg is the inductance of ... being somewhat voltage dependent Cav is the average capacitance of C1 and C2 in series (Figure 7(b)), calculated according to the method described in [9] The average capacitance is the ratio of the...
- 12
- 366
- 0
![Báo cáo khoa học: Characterization of the bioactive conformation of the C-terminal tripeptide Gly-Leu-Met-NH2 of substance P using [3-prolinoleucine10]SP analogues pdf](https://media.store123doc.com/images/document/14/rc/ty/small_tyq1394220086.jpg)
Báo cáo khoa học: Characterization of the bioactive conformation of the C-terminal tripeptide Gly-Leu-Met-NH2 of substance P using [3-prolinoleucine10]SP analogues pdf
... )75 )74 - 92 )91 ) 92 -57 -41 -54 )22 )41 ) 42 1 12 147 118 1 62 158 158 78 86 86 -30 -34 - 32 29 21 18 -29 -33 -31 30 25 24 32 28 28 -157 -164 -161 )95 )106 )107 -157 -1 63 -161 - 93 )1 02 )1 02 -91 )98 ... )97 177 60 -70 1 73 61 )68 177 59 -68 1 72 61 )68 1 73 60 )69 0.98 0.78 1 .37 3. 79 4.48 4 .39 0.14 0.00 0. 63 2. 53 3.41 3. 38 2. 80 3. 36 3. 38 2. 61 1 .29 2. 72 1.71 2. 62 2. 92 1.01 0 .22 1 .34 0.69 1.47 1.76 ... 82 )58 165 57 -70 171 82 )57 3. 39 1 .29 2. 92 4.90 5. 72 6.79 2. 27 0.00 1.71 3. 41 4.75 5.49 2. 61 1 .29 2. 72 3. 47 3. 49 4.75 1.01 0 .22 1 .34 1.91 2. 46 3. 45 a The selected conformers of the amino acid...
- 10
- 433
- 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... by association with color selection, the N2b has also become affiliated with general detection processes controlled at the level of the anterior cingulate cortex [ 23 ] The N2b is associated with ... potentials associated with selective attention to color: Developmental Int J Med Sci 20 05 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 changes from childhood to adulthood Psychophysiology ... into the nature of the ERP, the search for clinical integration will assuredly intensify Conflict of Interests The authors have declared that no conflict of interest exists 19 20 21 22 23 24 References...
- 8
- 563
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
... Form II figuresc 30 30 30 30 30 26 26 26 26 34 , 35 34 34 34 31 , 32 31 31 31 28 , 29 28 , 29 28 28 33 33 33 33 33 33 27 27 27 a Forms identified in parentheses appear to be more minor components, present ... 52 225 100 111 194 20 5 16 20 5 21 8 12 52 26 55 31 3 99 1 03 159 166 188 20 2 14 56 116 56e 171 185 190 20 1 20 24 2 25 2 1 13 58e 1 32 138 186 20 0 13 20 9 22 1 22 13 53 74 59e
- 16
- 549
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... 1045.8 42 124 4. 7 23 945.7 92 1174.001 32 5 7.0 2. 5- Hex Hex Hex 3. 0- Hex 3. 5- Hex GlcNAc 4.0- 1 539 .5 92 137 5.497 1.00.5600 800 1000 120 0 1400 1600 1800 20 00 22 00 24 00 26 00 28 00 30 00 32 0 0 m/z Fig The MALDI-TOF ... to the 5¢ and 3 ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ... GlcNAc, m ¼ 22 20. 12 Da) were also detected, which indicates that the presence of FEBS Journal 27 3 (20 06) 4 32 2 – 433 5 ª 20 06 The Authors Journal compilation ª 20 06 FEBS E Selinheimo et al Secreted tyrosinase...
- 14
- 650
- 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
... chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers + monomer 26 .8 43 25 . 521 25 . 831 60.906 62. 9 42 61. 025 78.7 03 77.878 78.051 84.7 03 87 .3 32 87.140 ... J Biochem 27 1) 7 23 23 Raymond, L., Morin, F.G & Marchessault, R.H (19 93) Degree of deacetylation of chitosan using conductometric titration and solid state NMR Carbohydr Res 24 6, 33 1 33 6 24 Domard, ... individual chains resulting from decrease in chain length, as evidenced by decreased molecular mass of LMWC The DA calculated using 13 C- NMR spectra was in accordance with the one calculated by IR-spectra...
- 11
- 673
- 0
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/small_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... 4.1–4 .2 (2H, m, Ar-O-CH2), 3. 71 (3H, s, O-CH3), 3. 4– 4.0 (5H, m, P+–CH2, H-11a and H -3) , 1.75 2. 4 (8H, m, O-CH2-CH2, P+–CH2-CH2, H-1 and H -2) p.p.m., 31 PNMR d 25 .65 p.p.m ESMS found (M+) 5 63 .24 69 ... Vinograd, J (19 73) The presence of ribonucleotides in mature closed-circular mitochondrial DNA Proc Natl Acad Sci USA 70, 33 39 33 43 37 Chappell, J.B & Hansford, R.G (19 72) Preparation of mitochondria ... millimolar concentration of mitoDC-81 within mitochondria on incubation of cells with high nanomolar to micromolar concentrations of mitoDC-81 This high local concentration of mitoDC-81 within mitochondria...
- 10
- 638
- 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... Hemmings, A.M & Richardson, D.J (20 02) Structure and spectroscopy of the periplasmic cytochrome c nitrite reductase from Escherichia coli Biochemistry 41, 29 21 29 31 17 Cunha, C. A., Macieira, S., Dias, ... 5 /2) whilst the remainders five are low-spin (S ¼ 1 /2) with gmax values at 3. 6, 3. 5, 3 .2, 3. 0 and 2. 96 [ 23 ,24 ] In this communication, we report for the first time the isolation and biochemical characterization...
- 12
- 593
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... sialic acid-speci c lectin was Ó FEBS 20 03 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 27 0) 435 3 isolated from the hemolymph of the marine crab Cancer antennarius [28 ] and Liocarcinus ... tubes containing 100 lL of 100 mM CaCl2 at a rate of 0 .3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because the lectin was unstable in the presence of EDTA The ... hemagglutination of purified lectin a Sugars HAI titer Minimum concentration required for inhibition in mM ManNAc GalNAc Lactose Glc6P GlcNAc Sucrose Fucose Glucose NeuAc NeuGc 32 16 16 8 2 3. 125 6 .25 6 .25 12. 5...
- 8
- 616
- 0
Tài liệu Báo cáo Y học: EPR characterization of the mononuclear Cu-containing Aspergillus japonicus quercetin 2,3-dioxygenase reveals dramatic changes upon anaerobic binding of substrates potx
... 5,7; 3 ,4¢ 2. 33 6; 11.4 5,7; none 2. 33 7; 11.0 5,7; 4¢ 2. 33 6; 11.0 5,7; 3 ,4¢,5¢ 2. 33 1; 11.5 5,7; 2 ,4¢ 2. 32 0 ; 14.1 5,7; 2 2. 31 5; 14.0 7; 3 ,4¢ 2. 31 0; 14.0 7; none 2. 31 1; 14.1 none; none Chemical ... gÆL)1 KH2PO4, gÆL)1 fructose, gÆL)1 MgSO4Æ7H2O, Egli trace elements (per L: 0.6 g EDTAÆ2H2O, 0.11 g CaCl2Æ2H2O, 75 mg FeSO4Æ7H2O, 28 mg MnSO4ÆH2O, 27 mg ZnSO4Æ7H2O, mg CuSO4Æ 5H2O, mg CoCl2Æ6H2O, ... [8] Comparison with A niger DSM 821 2, 3QD A niger DSM 821 2, 3QD is the only other 2, 3QD characterized by EPR [7] The main differences between 2, 3QD and A niger DSM 821 2, 3QD are that in the latter...
- 9
- 517
- 0
MASTERS OF WATERCOLOUR PAINTING WITH INTRODUCTION BY H. M. CUNDALL, I.S.O., F.S.A.EDITED BY GEOFFREY HOLME LONDON: THE STUDIO, LTD., 44 LEICESTER SQUARE, W.C.2 1922-1923.CONTENTSPAGE Introduction by H. M. Cundall, I.S.O., F.S.A. ILLUSTRATIONS IN COL docx
... publications with illustrations were produced These created a demand for 2topographical draughtsmen to assist the engravers In the catalogues of the Exhibitions of the Society of Artists, the ... of 20 % of the gross profits you derive from the use of Project Gutenberg-tm works calculated using the method you already use to calculate your applicable taxes The fee is owed to the owner of ... Pars, Richard Wilson and other artists of the early landscape school also painted the scene Cozens made many drawings of Nemi and the vicinity Two are in the Victoria and Albert Museum and another...
- 47
- 601
- 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... methionine c- lyases 27 28 29 30 31 32 33 34 35 36 37 38 39 in vivo against Trichomonas vaginalis Antimicrob Agents Chemother 45, 17 43 1745 Inoue H, Inagaki K, Adachi N, Tamura T, Esaki N, Soda K ... histolytica Acta Crystallogr F Struct Biol Cryst Commun 62, 1 034 –1 036 Nakayama T, Esaki N, Tanaka H & Soda K (1988) Chemical modification of cyseine residues of L-methionine c- lyase Agric Biol Chem 52, ... MGL1 (C1 10S) ( 72 118% of that of the wild-type) or increased 3 .2 4 .2- fold for MGL2 (C1 13S) In contrast to the Cys fi Ser mutation, the Cys fi Gly mutation caused 2. 5-fold and 1.4-fold increases in activity...
- 13
- 406
- 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... (Fig 2K) collecting at the low-density step together FEBS Journal 27 3 (20 06) 33 81 33 92 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 33 87 ¨ U Ortegren et al Identification of caveolae subclasses ... FEBS Journal 27 3 (20 06) 33 81 33 92 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 33 89 ¨ U Ortegren et al Identification of caveolae subclasses Preparation of subfractions of caveolae conjugated ... fluorescence confocal microscopy and electron microscopy to identify the HD-caveolae as speci c sites of fatty acid uptake and conversion to triacylglycerol, including the unique presence of fatty...
- 12
- 460
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... 3. 978 4.1 73* 3. 968 4 .20 5 4 . 23 8 2. 080* 3. 679* 3. 7 62* 3. 922 * 3. 855* 4.0 92* 4 .21 4 – – – – 4.696* 3. 9 12 3. 7 62 3. 996* 3. 938 4 .21 4 4 . 23 6 2. 0 73* 3. 6 72* 3. 758 3. 917 3. 848* 4.0 73* 4 .20 1* GalNAc (B) GlcA-ol ... C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C O C1 C2 C3 C4 C5 1 02. 83 71.54 67.51 109.41 147.01 – 1 02. 97 55. 02 78 .24 79.04 77.41 63. 91 25 .27 177.79 65.61 74.58 73. 04 82. 89 76.11 104 .25 72. 60 68.89 ... H2 H3 H4 H5 H6 H6¢ CH3 4.558* 3. 917* 3. 7 43 3.988* 3. 967* 4 .24 4 .24 2. 056* 4. 628 * 3. 480* 3. 638 3. 77 3. 77 3. 70 3. 72 4 .29 5 4 .25 7 4.4 92* 4.146* 3. 705 3. 705 2. 018* 4.589* 3. 930 * 3. 745 4.0 02* ...
- 11
- 481
- 0
Báo cáo khoa học: Spectroscopic characterization of the isolated heme-bound PAS-B domain of neuronal PAS domain protein 2 associated with circadian rhythms doc
... mutant, 5¢-CTGG CCAGGTGCGCCCAGCATCTGATG -3 and 5¢-CATCA GATGCTGGGCGCACCTGGCCAG -3 for the His300Ala mutant, 5¢-GTGCCACCAGGCTCTGATGCAGTTTGG -3 and 5¢-CCAAACTGCATCAGAGCCTGGTGGCAC -3 for the His302Ala ... 5¢-GGTTGCAAACCGCCTACTA CATCACCTAC -3 and 5¢-GTAGGTGATGTAGTAGGC GGTTTGCAACC -3 for the His 32 9 Ala mutant, and 5¢CTACATCACCTACGCCCAATGGAACTCC -3 and 5¢GGAGTTCCATTGGGCGTAGGTGATGTAG -3 for the His 335 Ala ... 5¢-ATTTCTGGATGCCAGAGCTCCTCCAATC -3 and 5¢-GATTGGAGGAGCTCTGGCATCCAGAAAT -3 for the His266Ala mutant, 5¢-GGCTACGACTACTACGC CATTGATGACC -3 and 5¢-GGTCATCAATGGCGTAG TAGTCGTAGCC -3 for the His289Ala...
- 10
- 360
- 0
Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt
... T109 N 124 K58 N40 S 138 V69 R1 63 S1 32 V 136 I168 L35 V61 N40 C4 S 134 Y118 A28 Y 133 S7 T56 R60 Q156 Q117 E44 G1 72 Y165 F 135 F86 M 73 A57 N66 A55 M 73 A 130 F77 M 53 G75 T 128 A57 L 122 Q98 A26 G 22 C1 20 group ... Phe20–Phe 137 and for Phe36– ˚ Tyr 133 the distance ranges are 3 .2 15 .3 A and ˚ , respectively, in the group conformers 2. 9– 13. 8 A (Fig 4) These changes in the packing of aromatic side chains in the ... F 135 A 43 L37 Y1 73 F77 V74 V6 E 72 R 62 R166 G 127 A 43 V 93 E39 Q38 L 125 S21 A55 G75 L 125 Q149 E68 E158 R5 E16 E39 L144 G1 72 R10 Y111 E1 12 K99 K30 V107 R19 S46 G 92 K 12 N171 T 128 T80 N14 T1 13 S54 V 42 E108...
- 13
- 321
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... on wood chips as the sole carbon source In addition, 2BW-1 also grew in the lignin-related compounds, p-hydroxybenzoic acid, gallic acid and vanillic acid, as a sole source of carbon Cell growth ... FEBS 20 03 23 60 Y Otsuka et al (Eur J Biochem 27 0) Fig Mass spectra of guaiacylglycerol and guaiacol, products of the b-aryl ether cleavage reaction The reaction products of GOG generated by the ... Purification (fold) Recovery Culture medium Ultrafiltration (30 kDa) Sephadex G-75 Mono Q 20 0 5 520 32 5 4 591 426 3. 9 31 .3 49.4 1 .3 10 .27 16 .2 100 115 38 34 solution of enzyme (1 mgÆmL)1) and 20 lL of...
- 10
- 670
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25