Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform Alessandra Gambacurta 1 *, Laura Fiorucci 1 *, Paolo Basili 1 , Fulvio Erba 1 , Angela Amoresano 2 and Franca Ascoli 1 1 Department of Experimental Medicine and Biochemical Sciences, University of Rome ‘Tor Vergata’, Rome; 2 Department of Organic Chemistry and Biochemistry, University of Naples ‘Federico II’, Naples, Italy A complementary DNA encoding a new bovine tryptase isoform (here named BLT) was cloned and sequenced from lung tissue. Analysis of sequence indicates the pres- ence of a 26-amino acid prepro-sequence and a 245 amino acid catalytic domain. It contains six different residues when compared with the previously characterized tryptase from bovine liver capsule (BLCT), with the most signifi- cant difference residing at the primary specificity S1 pocket. In BLT, the canonical residues Asp-Ser are pres- ent at positions 188–189, while in BLCT these positions are occupied by residues Asn-Phe. This finding was con- firmed by mass fingerprinting of the peptide mixture obtained upon in-gel tryptic digestion of BLT. Analysis by gel filtration of the purified protein shows that BLT is probably tetrameric, similar to the previously identified tryptases from other species, with monomer migrating as 35–40 kDa multiple bands in SDS/PAGE. As expected, the catalytic abilities of the two bovine tryptases are dif- ferent. The specificity constant values (k cat /K m ) assayed with model substrates are 10- to 60-fold higher in the case of BLT. The tissue-specific expression of the two tryptases was evaluated at the RNA level by analysis of their dif- ferent restriction patterns. In lung, only BLT was found to be expressed, while in liver capsule only BLCT is present. Both isoforms are distributed in similar amounts in heart and spleen. Analysis of the two gene sequences reveals the presence of several recognition sequences in the promoter regions and suggest a role for hormones in governing the mechanism of tissue expression of bovine tryptases. Keywords: bovine tryptases; aprotinin; tissue expression; promoter sequences; mass spectrometry. Tryptases are trypsin-like proteinases stored in the secretory granules of human [1–3], dog [4,5], rat [6–8], mouse [9,10], bovine [11], gerbil [12] and sheep [13] mast cells. These enzymes are released along with other mediators into the extracellular medium upon mast cell activation/degranula- tion. Although their patho-physiological role is not yet understood, tryptases seem to be involved in several mast cell-mediated allergic and inflammatory diseases. However, the underlying molecular mechanism, as well as the proenzyme/polypeptide target(s) of these enzymes have not been identified yet, in spite of their involvement in a variety of biochemical reactions in vitro [14–18]. Recently it was shown that human tryptase activates by proteolytic cleavage the proteinase-activated receptor 2, inducing widespread inflammation by an unknown mechanism and possibly contributing to the proinflammatory effects of mast cells in human diseases [19]. Almost all tryptases are made of glycosylated 245 residue identical subunits, which share many characteristics with the prototype enzyme trypsin (225 residues), in terms of sequence (identity around 45%) and overall folding. How- ever, two main features are peculiar to tryptases. One feature is the tetrameric structure of most tryptases studied so far, which is necessary for biological activity and is maintained in vivo through association with heparin; in many cases this glycosaminoglycan is required for stabi- lization of the enzyme after its release from mast cells [20,21]. In the 3 A ˚ crystal structure of the tetrameric bII human enzyme (molecular mass 120–140 kDa), the active site of each monomer faces a central oval pore, whose dimension limits the accessibility for macromolecular substrates/inhi- bitors [22]. A second common feature of tryptases seems to be their occurrence as a multigene family: in humans, at least four homologous tryptase cDNAs (tryptases a and bI–III) have been isolated [23–25] and a gene cluster was Correspondence to Franca Ascoli, Department of Experimental Medicine and Biochemical Sciences, University of Rome ÔTor VergataÕ, Via Montpellier 1, 00133 Rome, Italy. Fax: + 39 06 72596477; Tel.: + 39 06 72596474; E-mail: ascoli@uniroma2.it Abbreviations: BLCT, bovine liver capsule tryptase; BLT, bovine lung tryptase; Boc, t-butyloxycarbonyl; BPTI, bovine pancreatic trypsin inhibitor; DFP, diisopropylfluoro-phosphate; MCA, methyl- coumarin; MUGB, 4-methylumbelliferyl p-guanidinobenzoate; STI, soybean trypsin inhibitor; Z, benzyloxycarbonyl. Dedication: This paper is dedicated to the memory of Eraldo Antonini, eminent biochemist, prematurely deceased twenty years ago, on March 19th 1983. Note: nucleotide sequence data are available in the GenBank database with the accession numbers AF515641 (full-length bovine lung tryptase cDNA), X94982 (full-length bovine liver capsule tryptase cDNA), AF515642 (bovine lung tryptase promoter) and AF516175 (bovine liver capsule tryptase promoter). *These authors contributed equally to this work. (Received 8 October 2002, revised 20 November 2002, accepted 29 November 2002) Eur. J. Biochem. 270, 507–517 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03406.x identified for multiple human tryptases [26]; two tryptases (mMCP-6 and mMCP-7) have been identified in mouse [9,10], and their genes isolated [27,28]. In a previous paper [11], we reported isolation of a tryptase isoform (BLCT) from bovine liver connective capsule (Glisson capsule). This enzyme is made of 245 amino acid (aa) subunits; its sequence was determined either biochemi- cally on the purified protein or by isolating and sequencing its cDNA [29]. The most peculiar and important difference between BLCT and other tryptases analyzed so far occurs at positions 188–189 of the primary specificity pocket S1, where the basic side chain of the substrate P1 residue, Arg or Lys (whose carbonyl group belongs to the scissile peptide bond of the substrate), is accommodated. In BLCT, residues Asn188 and Phe189 replace the canonical residues Asp and Ser, respectively, present in all other tryptases and in all trypsin- like enzymes. However, these substitutions do not affect significantly the substrate specificity of the bovine enzyme. In this paper, we report cloning of a new cDNA from bovine lung encoding a tryptase isoform (BLT) with the usual doublet Asp-Ser in the S1 specificity pocket and isolation of the corresponding protein. Sequence analysis by mass spectrometry and partial characterization of BLT revealed more similarities between this enzyme and b-type tryptases from other species with respect to BLCT. Some evidence on tissue-specific expression of the two isoforms in different bovine tissues is also reported and in this light the different sequence of the two tryptase gene promoter regions are discussed. Experimental procedures Oligonucleotide primers and restriction enzymes PCR primers were obtained from MWG Biotech (Italy), Genset (France) or Pharmacia (Italy). Their numbering refers to the first nucleotide (+1) of cDNA start codon. Restriction enzymes were obtained from New England Biolabs (USA). Amplification reaction (PCR), cloning and sequence analysis Unless otherwise indicated, PCRs were conducted using 5U of Taq polymerase (Perkin Elmer, USA), 200 m M dNTPs, 1.5 m M MgCl 2 ,10m M Tris/HCl, pH 8.3, 50 m M KCl (50 lL final volume). All PCR products were size- fractionated by agarose gel electrophoresis and the bands eluted, purified and subcloned in the PCRII TM TOPO vector containing the lac promoter and the b-galactosidase gene, using the TA Cloning Kit (Invitrogen, USA). Transformation was performed in the TOP 10 cells, the positive clones were isolated and their nucleotide sequence determined. Sequence analysis was performed on both strands by the dideoxy-chain termination method, either using the Sequenase 2.0 Kit (Amersham Pharmacia Biotech Italia) or automatically. cDNA synthesis mRNA was prepared from various bovine tissues using the Fast Track kit (Invitrogen, USA). The first strand cDNA was synthesized at 42 °C using 0.1–1 lgofmRNAwiththe cDNA cycle kit (Invitrogen). To obtain partial cDNAs encoding tryptases (see Results) PCRs were performed as already described [29], using 2 lL of the RT reaction products and the primer pair N9 (nt 127–153, 5¢-AGC CTGAGAGTCAGCCGTCGGTACTGG-3¢)andN10 (nt 790–816 antisense, 5¢-TCAGGGCCCCTGGGGGAC GTACTGGTG-3¢). Entire tryptase cDNAs were obtained under the same conditions, at the annealing temperature of 58 °C, using the primer pair Met (nt 1–20, 5¢-ATG CTCCATCTGCTGGCGCT-3¢, designed on the basis of the 5¢ RACE experiments reported below) and Coda [5¢-CGCGCGCG(T) 16 )3¢] [29] and sequenced. 5¢ Rapid amplification of cDNA ends (RACE) 5¢ RACE was carried out to determine the 5¢ nucleotide sequence of the tryptase full-length transcripts, using the RACE System from Gibco (Paisley, USA). One hundred nanograms of bovine lung and hepatic capsule mRNAs were reverse transcribed using oligo-dT as primer. After purification of the first strand cDNA, a dC tail was added to the 3¢ end using dCTP and terminal transferase. PCRs were conducted on 5 lLoftheÔtailing reactionÕ,usingthe 5¢ RACE abridged universal amplification primer AUAP with a 3¢-G tail (5¢-GGCCACGCGTCGACTAG TACGGGGGGGGGGGGGG-3¢)as5¢ primer and C1 (nt 537–563 antisense, 5¢-TACTTCCTGTCACAGACAC TGTTCTCC-3¢)as3¢ primer. Nested PCRs were then performed using the same 5¢ primer and C2 (nt 372– 396 antisense, 5¢-GTGCCAGGAGATATTCACAAGCT TG-3¢)as3¢ primer. Amplification reactions were con- ducted using 40 pmol of each primer, under the following conditions: 2 min at 94 °C (1 cycle), 1 min at 94 °C, 1 min at 58 °C, 1 min at 72 °C (30 cycles) and 10 min at 72 °C (1 cycle). Evaluation of tissue distribution of bovine tryptases In order to ascertain the expression of one or both tryptase isoforms (see Results) in different bovine tissues, tryptase cDNAs were prepared as described above from mRNAs isolated from bovine liver capsule, lung, heart and spleen. The amplification profile was optimized as follows: 1 min at 94 °C (1 cycle), 1 min at 94 °C, 1 min at 58 °C, 2 min at 72 °C (30–40 cycles) and 10 min at 72 °C(1cycle).The RT-PCR products were separated by electrophoresis through a 1.5% (w/v) agarose gel, eluted, cloned in a TA vector and transformed in the TOP 10 competent cells. The positive clones were identified by restriction analysis with NspI (overnight at 37 °C) and sequenced. Identification of 5¢ flanking sequences and UTRs of bovine tryptase genes A strategy similar to that described in the protocol of the Universal Genome Walker Kit (CLONTECH, USA) was employed to identify 5¢ flanking sequences and UTRs of the tryptase genes. Genomic DNA was obtained from bovine liver using the DNA TURBOGEN Kit (Invitrogen, USA) at a final concentration of 100 ngÆlL )1 and the molecular weight was 508 A. Gambacurta et al. (Eur. J. Biochem. 270) Ó FEBS 2003 checked by 0.8% (w/v) agarose gel electrophoresis. Genomic DNA(500ng)wasthendigestedwith10Uofthe restriction enzymes HincII, EcoRV, MscI, SspI, in four separate reactions. Each digested sample was ligated with the annealed adaptor oligonucleotides A1 (5¢-GTAATAC GACTCACTATAGGGCACGCGTGGTCGAC-3¢)and A2 (5¢-GTCGACCACGCGTGC-3¢, complementary to 15 nt of the A1 3¢ region). Amplification reactions were then conducted for each digested and ligated genomic DNA sample (10 lL), using 20 pmoles of each primer (see below) and 5 U of the ÔElongase enzyme mixÕ (Gibco) in 60 m M Tris sulfate pH 9.1, 18 m M ammonium sulfate, 1 m M magnesium sulfate and 1.5 m M magnesium chloride, in a final reaction volume of 50 lL. The conditions used were: 1 min at 94 °C(1cycle), 1minat94°C, 1 min at 55 °C(5¢ region) or at 52 °C(3¢ region), 4 min at 68 °C (32 cycles) and 5 min at 68 °C(1 cycle). Two microliters of each PCR was then used as a template in a nested PCR under the same conditions. The following oligonucleotides were used as primers: AP1 (5¢- GTAATACGACTCACTATAGGGC-3¢, identical to 22 nt of the A1 5¢ region); AP2 (5¢-ACTATAGG GCACGCGTG GT-3¢, identical to 12 internal nt of A1); C3 (nt 41–61 antisense, 5¢-CCTGGCCAGGGGCTGCG GAGA-3¢); C4 (nt 34–54 antisense, 5¢-AGGGGCTGCGGAGACCAGG CT-3¢). The primer pairs AP1/C3 and AP2/C4 were used in the first and in the nested PCR, respectively. In order to assign the two 5¢ sequences obtained (from the genomic DNA sample digested with HincII, see Results) to the two bovine tryptase genes, two different PCRs were conducted, using as a template genomic DNA and the primer pairs U1a/N10 and U1b/N10, respectively. Primers U1a (5¢-AGATGAAGGAATTAGTAGTTTAATGG-3¢, nt ) 374 to )399) and U1b (5¢-ATTAATTTCAGTTTA AAAGAGCTACT-3¢,nt) 374 to ) 399) were designed on thebasisofthe5¢ sequences obtained (a and b). N10 sequence is reported above. Amplification was conducted using 20 pmol of each primer and 100 ng digenomic DNA, with the following parameters: 1 min at 94 °C(1cycle); 1mina94°C; 1 min at 64 °C; 4 min at 72 °C (32 cycles); 5 min at 72 °C (1 cycle). The PCR products were size- fractionated by electrophoresis through a 1% (w/v) agarose gel. After cloning, the PCR II TM TOPO vectors, containing the inserts, were digested with the restriction enzyme NspIto distinguish between the sequences encoding the two differ- ent bovine tryptases (see Results). Organization of bovine tryptase genes and location of intron II–V Intron II–V length of the two genes encoding bovine tryptases was evaluated by amplification of bovine genomic DNA, using the following primer pairs: Met/C7 for intron II amplification; N9/C6 for intron III amplification; C8/C1 for intron IV amplification; C5/N10 for intron V amplification. Sequences of primers Met, C1, N9 and N10 are reported above. Other primers used are: C5, 5¢-CCGTCGTGGAGAACAGTGTC-3¢ (nt 530–549); C6, 5¢-TGTCCGCCCCGTTCTTAACGCTGTA-3¢ (nt 328– 352, antisense); C7, 5¢-ACGATGCCCGCGCGCTG-3¢ (nt 67–83, antisense); C8, 5¢-ACGGGCTGGGGCAA CGTGG-3¢ (nt 460–478). The primer pair sequences correspond to cDNA sequences at the intron/exon junctions, deduced from the homologous sequences of human and murine tryptase genes. PCRs were conducted using 100 ng of genomic DNA as a template, 20 pmol of each primer, and the following conditions for amplification: 3 min at 94 °C (1 cycle), 1 min at 94 °C; 1 min at the annealing temperature; 30 s at 72 °C (30 cycles); 5 min at 72 °C (1 cycle). Annealing temperatures were: 58 °Cfor amplification of introns II and III, 60 °C for intron IV and 62 °C for intron V. The PCR products were size-fraction- ated by electrophoresis through a 1% (w/v) agarose gel, eluted, cloned in the PCR II TM TOPO vectors and sequenced. Purification of bovine tryptases BLCT and BLT were purified as previously described for bovine liver capsule tryptase [11], except that, in the case of the lung enzyme, the three step procedure (high-salt extraction followed by hydrophobic chromatography on octyl sepharose and then an heparin affinity column) was carried out using pH 5.5 buffers. Tryptase enzymatic activity was routinely assayed at 30 °C monitoring the fluorescence of 7-amino-4-methyl-coumarin released from Boc-Phe-Ser-Arg-MCA substrate (Sigma Chemical Co., USA), as reported previously [11]. The tryptase-containing fractions eluted from the heparin column were concentrated with an Amicon stirred-cell concentrator equipped with a 30 kDa cut-off membrane and stored at )20 °Cinthe heparin column elution buffer containing 20% (v/v) glycerol. Lung tryptase was purified further by gel filtration chromatography. The enzyme sample was diluted with four volumes of 10 m M Mes pH 5.5 and injected (100 lL) at a 50 lLÆmL )1 flow rate onto a Superose 12PC column (Pharmacia, Italy) pre-equilibrated with the gel filtration buffer (10 m M Mes, 0.4 M NaCl, pH 5.5). Protein was detected spectrophotometrically at 280 nm and 100 lL fractions were collected. Tryptase activity in each fraction was measured as described previously. The fractions containing tryptase activity were pooled and used for characterization of the enzyme. For determination of BLT molecular weight, the three most active fractions were pooled, preincubated with heparin (10 lgÆmL )1 ,10minat room temperature), and reloaded (20 lL) on the gel filtration column as above. Tryptase concentrations were determined by active site titration with 4-methylumbelliferyl p-guanidinobenzoate (MUGB) (Sigma Chemical Co., USA) for the lung enzyme as reported in [30], and with radioactive diisopropylfluoro- phosphate ([ 3 H]DFP) (New England Nuclear, UK) for the liver capsule enzyme, as already described [11]. Western blotting was performed as already reported using an anti- (178/191-tryptase-peptide) Ig [31]. Mass spectrometry analysis Mass spectrometric analysis was performed on the Coo- massie blue-stained BLT protein excised from a preparative SDS electrophoresis on a 14% (w/v) polyacrylamide gel. The excised band was washed first with acetonitrile and then with 0.1 M ammonium bicarbonate. Protein samples were reduced by incubation in 10 m M dithiothreitol for 45 min at Ó FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 509 56 °C. The gel particles were then washed with ammonium bicarbonate and acetonitrile. Enzymatic digestion was carried out with trypsin (Sigma Chemical Co., USA) at a final concentration of 15 ngÆmL )1 in 50 m M ammonium bicarbonate pH 8.5, at 4 °C for 4 h. The buffer solution was then removed and a new aliquot of the enzyme/buffer solution was added for 18 h at 37 °C. A minimum reaction volume, sufficient for complete rehydration of the gel was used. Peptides were then extracted washing the gel particles with 20 m M ammonium bicarbonate and 0.1% (v/v) trifluoroacetic acid in 50% (v/v) acetonitrile at room temperature and then lyophilized. MALDI mass spectra were recorded using a Applied Biosystem Voyager DE-Pro reflector instrument. A mixture of analyte solution and a-cyanohydroxycinnamic acid [10 mgÆmL )1 in acetonitrile/ethyl alcohol/0.1% trifluoro- acetic acid (1 : 1 : 1 v/v/v)] was applied to the metallic sample plate and dried under vacuum. Mass calibration was performed using external standards. Raw data were analyzed using computer software provided by the manu- facturer and reported as monoisotopic masses. Enzymatic assays Rate assays for the determination of kinetic constants with 7-amino-4-methyl-coumarin (MCA) peptide substrates (Sigma Chemical Co., USA) were started by addition of the enzyme (BLT or BLCT) to 0.1 M Tris/HCl, pH 8.0, containing the various substrates in a total reaction volume of 2.0 mL maintained at 25 °C during measurements. Hydrolysis of MCA substrates was monitored using an excitation wavelength of 370 nm and an emission wave- length of 460 nm in a Kontron spectrofluorimeter. k cat /K m values were determined under pseudo first-order conditions. For all substrates [S ° ]was K m . Progress curves were fitted using an exponential function to obtain k obs ; k obs /[E] was usedtoobtaink cat /K m , where [E] represents the enzyme concentration. To test for susceptibility of BLT to inhibition, the enzyme (5 n M active sites) and various inhibitors were mixed in 2 mL of the assay buffer and maintained at 30 °Cfor 30 min. Then 20 lLof1.5m M Boc-Phe-Ser-Arg-MCA were added and residual activity was determined as described above by comparison with that of an identical enzyme incubation mixture containing no inhibitor. Results Cloning and sequence analysis of full-length tryptase cDNAs A partial cDNA (690 bp) encoding a new bovine tryptase isoform (BLT) was obtained from lung mRNA by RT-PCR, using primers N9 and N10, and by subsequent cloning and sequencing. Based on this partial sequence, 5¢ RACE experiments and RT-PCR (using the primer pair Met and Coda) were performed as described in the Experimental Procedures. The full-length BLT cDNA consists of 1078 bp, including the 5¢ untranslated 20 nt. Its sequence is reported in Fig. 1A, with the deduced protein sequence. An ATG codon is present 20 nt downstream of the 5¢-end, the stop codon following after 813 nt. Thus, a 271 residue protein precursor chain is encoded by a single open reading frame. The 242 bp 3¢-UTR, with a polyade- nylation signal at nt 1039–1043, is identical in the initial 100bptothe3¢-UTR of BLCT cDNA [29], with an overall difference in 71 positions. Full-length BLCT cDNA sequence of 1031 nt (Fig. 1B) was similarly obtained from liver capsule mRNA, by 5¢ RACE experiments and RT-PCR. The BLCT sequence previously reported [29] is now confirmed by the sequence of the full-length BLCT cDNA, except for residue 11 of the mature protein, in that it possesses Arg rather than Gln in this position (see Fig. 2). When the deduced amino acid sequence of BLT is compared with that of BLCT and other tryptases (Fig. 2), it is evident that the first 26 aa residues of both bovine isoforms represent the prepro-sequence, the mature protein starting with residues IVGG, the canonical N-terminal sequence of tryptases. The serine protease catalytic triad residues (His44, Asp91 and Ser194) and eight cysteine residues building the predicted intrachain disulfide bonds are well conserved, as are many other sequence regions. Three putative N-linked glycosylation sites at positions 102 (NIS), 171 (NVS) and 203 (NGT) are present in BLT, whereas only two glycosylation sites were found in BLCT [29], gerbil tryptase [12] and sheep tryptases 1 and 2 [13]. The sequence identity of BLT is about 98% with BLCT (corresponding to six different residues), 70–74% with tryptases from other species, except in the case of sheep tryptases 1 and 2 [13], where the identity reaches 82–83%. The major and more significant difference between BLT and BLCT resides at positions 188–189 of the S1 specificity pocket. In BLCT they are occupied by residues Asn-Phe (from full-length cDNA sequencing, in agreement with previously reported partial cDNA and protein sequencing [29]), while in BLT the canonical residues Asp-Ser are present, as in all tryptases from other species (see also below for the biochemical analysis of the purified protein). Tissue-distribution and expression pattern of bovine tryptases Another interesting difference between the two bovine tryptase isoforms occurs at residue 179, which is Met in BLCT, as in many other tryptases, and is Asn in BLT (see Fig. 2), while residues 178 and 180 are identical in the two enzymes. This results, only in BLCT cDNA, in a restriction site (ACATGT) for NspI endonuclease. Thus, when treated with this enzyme, BLT and BLCT cDNAs, cloned into the TA vector, show a different restriction pattern. BLT insert results in an undigested band, while in the BLCT insert the presence of the restriction site gives rise to two bands. We took advantage of this different restriction pattern with NspI to evaluate the distribution of bovine tryptases in different tissues (lung, heart, spleen and liver capsule). The results, reported in Fig. 3, show that in lung only BLT is expressed, while in liver capsule only BLCT cDNA is present, in agreement with our previous results [29]. On the contrary, in heart and spleen both isoforms are expressed. We were unable to detect BLCT mRNA in lung and BLT mRNA in the liver capsule, even when 40 cycles of PCR were performed to allow identification of low abundant transcripts. 510 A. Gambacurta et al. (Eur. J. Biochem. 270) Ó FEBS 2003 A -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC 72 M L H L L A L A L L L S L V S A A P G Q A L Q R (-3) GCGGGCATCGTCGGGGGGCAGGAGGCCCCTGGGAGCAGATGGCCCTGGCAGGTGAGCCTGAGAGTCAGCCGT 144 A G I V G G Q E A P G S R W P W Q V S L R V S R (22) CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216 R Y W R H H C G G S L I H P Q W V L T A A H C V (46) • GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGTGAGCAGCACCTGTATTACCAGGACCAG 288 G P E V H G P S Y F R V Q L R E Q H L Y Y Q D Q (70) CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTACTACAGCGTTAAGAACGGTGCGGACATCGCCCTG 360 L L P I S R I I P H P N Y Y S V K N G A D I A L (94) • CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCTGGTCACCCTGCCCCCTGAGTCGGAGACC 432 L E L D K L V N I S W H V Q L V T L P P E S E T (118) * TTTCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504 F P P G T Q C W V T G W G N V D N G R R L P P P (142) TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576 F P L K Q V K V P V V E N S V C D R K Y H S G L (166) TCCACAGGGGACAACGTATCCATAGTGCAGGAGGATAACTTGTGTGCTGGGGACAGCGGGAGGGACTCCTGC 648 S T G D N V S I V Q E D N L C A G D S G R D S C (190) * CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720 Q G D S G G P L V C K V N G T W L Q A G V V S W (214) • * GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 G D G C A K P N R P G I Y T R V T S Y L D W I H (238) CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC 72 GCGGGCATCGTCGGGGGGCAGGAGGCCCCTGGGAGCAGATGGCCCTGGCAGGTGAGCCTGAGAGTCAGCCGT 144 CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504 TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576 TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC 648 CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720 GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc 936 ccacacctgatgaccccactcctggctgtacccctctcccgctcagctcacccccccgcaggggctgctgac 1008 actcattaaagagcatggagagg 1031 Fig. 1. Full-length bovine tryptase cDNAs. Nucleotide numbering begins at the first nucleotide of the preprosequence. Stop codon (r)and polyadenylation signal (underlined) are indicated. (A) BLT cDNA and deduced amino acid sequence. Potential N-linked glycosylation sites (w), residues of the serine protease catalytic triad (d) and residues identified by mass spectrometry (underlined) are indicated. Amino acid numbering startsatthefirstresidueofthematureprotein.(B)BLCTcDNA(seealso[29]). Ó FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 511 Promoter analysis and organization of tryptase genes In order to obtain information on the promoter regions of the two tryptase genes, the amplification products obtained from bovine genomic DNA, digested and modified as described above, were analyzed on agarose gel. Two distinct, prominent bands were obtained in the case of genomic DNA digested with HincII. After cloning and sequencing, it was possible to assign each 5¢ region to one of the two tryptase (BLT and BLCT) genes, which were amplified with the proper primer pairs and subjected to restriction analysis with NspI (see Materials and methods). The two promoter sequences and 5¢-UTRs are reported in Fig. 4, where the regulatory sequences found using the TRANSFAC 4.0 program are highlighted. The same figure shows that in both sequences intron I is present in phase 0 just upstream the initiation codon, as found in most tryptases. Location and phase of introns II–V were evaluated as reported under Material and methods and were found identical (data not shown) to those of human tryptases [26]. Moreover, in searching for location and phase of intron V, we sequenced exon regions of BLT and BLCT genes corresponding to amino acid residues 158–245. These regions include the five residues (out of six) which are different in the two tryptases and the results confirm once again the presence of Asn188- Phe189 in BLCT, unlike BLT and tryptases from other species which contain Asp-Ser in those positions. Isolation and characterization of bovine lung tryptase We routinely purified tryptase from bovine liver capsule using an high salt extraction followed by a two-column purification. The whole procedure was carried out at pH 6.1. Based on active site titration with [ 3 H]DFP, a typical heparin pooled fraction contains 0.3 nmol of active Fig. 2. Comparison of amino acid sequences of BLT, BLCT and tryptases from other species. The compared sequences are: BLT (this work), BLCT [29], human tryptase bII [25], human tryptase a [23,42] and sheep tryptase 1 [13]. Residues identical in BLT and other tryptases are indicated by a point (Æ). Num- bering begins at the first residue of the mature proteins. Fig. 3. Differential NspI restriction of bovine tryptase cDNAs in dif- ferent tissues. Agarose 1.7% (w/v) gel electrophoresis of the TA vector- cloned-bovine tryptase cDNAs obtained from bovine lung, heart, spleen and liver capsule, was performed after treatment with NspI endonuclease. Arrows indicate the bands corresponding to the NspI- undigested BLT insert (lung; heart, lane b; spleen, lane b) and to the NspI-digestion products of the BLCT insert (heart, lane a; spleen, lane a; liver capsule). The two upper bands in all lanes represent the NspI- digested TA vectors. Lane MW, DNA marker (1 kb ladder). 512 A. Gambacurta et al. (Eur. J. Biochem. 270) Ó FEBS 2003 sitesÆg )1 of wet tissue. The specific activity of BLCT in the standard assay containing 75 l M Boc-Phe-Ser-Arg-MCA is 190 pmol MCA min -1 (pmol of tryptase subunit) )1 . BLCT is stable and maintains its full activity for about two to three weeks when kept at 4 °Cinhighsaltat pH 6.1. Inthecaseofbovinelung,wewereabletoisolatetryptase only after lowering the buffer pH to 5.5. The lower pH resulted in increased adsorption to the resins and increased stability of tryptase activity. Fractions with tryptic activity, eluted from the heparin column, were pooled, concentrated and analyzed by SDS/PAGE. To further purify the still heterogeneous sample, the concentrated pooled fraction was loaded on a gel filtration column and the elution profile at 280 nm showed several peaks. The fractions containing tryptic activity were then pooled and reacted with radiolabeled DFP. SDS/PAGE followed by fluoro- graphy yielded bands only in the 35–40 kDa range (data not shown). The same multiple bands were detected with the anti-(178/191 tryptase-peptide) Ig, using BLCT as control [31] (inset of Fig. 5). The multiple banding pattern is probably due to variable glycosylation of two/three different sites. Reloading of the BLT sample, preincubated with heparin, on the gel filtration column yielded a symmetrical peak displaying enzymatic activity and migrating with an apparent molecular weight of  200 kDa (Fig. 5). This size is in reasonable agreement with a tetramer bound to heparin. A minor peak with no activity and an elution volume equivalent to a molecular mass of  35 kDa was present. To test for catalytic activity, BLT was titrated with the burst titrant MUGB. Approximately 6 lgofactivelung tryptase was obtained with this procedure (4 pmol active sitesÆg )1 of wet tissue, assuming M r ¼ 35 000). The specific activity of BLT in the standard assay containing 75 l M Boc-Phe-Ser-Arg-MCA is 870 pmol MCA min )1 (pmol of tryptase subunit) )1 . Based on a protein assay and active site titration with MUGB, our tryptase preparation was 52% active. MALDI mass spectrometry analysis was performed on about 50 pmol of Coomassie blue-stained BLT, from the SDS/PAGE, which were subjected to in-gel tryptic diges- tion. We took precautions during gel electrophoresis to avoid formation of acrylamide adducts and used only the best and purest chemicals and solvents available throughout the entire purification process. The peptides were extracted from the gel as described above and the mixture was directly analyzed by MALDI mass spectrometry. This gave predominantly singly charged fragments, allowing easier interpretation of masses observed for peptide mixtures than is the case for spectra generated by electrospray mass spectrometry. From the MALDI mass spectra (Fig. 6), it was possible to recover and identify peptides from the entire sequence of BLT. As shown in Table 1, we were able to match all peptide masses with the amino acid sequence as deduced from the cDNA clone. More than 80% of BLT sequence (see also underlined residues in Fig. 1) was covered with an adequate mass accuracy (better than 0.1%, Table 1). In particular, the products with ion signals at m/-z 1490.7 and 1366.2 represent the peptides that characterize BLT isoform with respect to BLCT isoform (corresponding to peptides 167–180 and 188–201, with theoretical M r s of 1490.5 and 1365.7, respectively). BLT was highly reactive toward tripeptide coumarin- containing substrates, especially those with basic amino acid in P1 and P2 positions exhibiting k cat /K m values of about 10 6 M )1 Æs )1 . In Table 2 the catalytic efficiency vs. tripeptide and single residue substrates is reported in comparison with the activity of BLCT. k cat /K m values for both enzymes were determined at the same pH and temperature and under pseudo first-order conditions. For all substrates BLT was a more efficient catalyst then BLCT (10- to 60-fold) and both enzymes exhibited a dramatic drop in catalytic ability in Fig. 4. Comparison of promoter sequences and 5¢-UTRs in BLT and BLCT genes. Identical nucleotides are indicated (w). Putative TATA, CAAT and GC box sequences are underlined. Binding sites for specific transcription factors (indicated) are boxed. Intron I sequence is reported in lower case. Numbering begins at the transcription initiation site (in bold). Ó FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 513 going from tripeptide to single-residue substrates (about 10 4 and 10 2 M )1 Æs )1 , respectively). As shown in Table 3, BLT was inactivated by low molecular weight inhibitors of tryptic proteases. Like other tryptases it is essentially unaffected by large serine protease inhibitors as STI and a-1-antitrypsin. However, BPTI (or aprotinin, the trypsin inhibitor present in bovine mast cells), causes a significant reduction in BLT activity, similarly to what previously found for BLCT [11,32]. Discussion In previous studies, we reported isolation of tryptase (then named BLCT) from bovine liver capsule and its characteri- zation [11,29]. BLCT was the only tryptase found in that Fig. 5. Gel filtration analysis of purified BLT. BLT, preincubated with heparin (10 lgÆmL )1 ), was chromatographed on a Superose 12PC column preequilibrated with 10 m M Mes, 0.4 M NaCl,pH 5.5.Protein was detected spectrophotometrically at 280 nm and 100 lLfractions were collected. Tryptase activity in each fraction was measured as described in the text and reported as percent of the most active fraction. Elution positions of blue dextran (void volume), catalase (220 kDa), ovalbumin (43 kDa) and ribonuclease (13.7 kDa) are indicated by arrows. In the inset the immunodetection of purified BLCT (a) and of BLT (b) is shown. Fig. 6. MALDI mass spectrometry analysis of peptides obtained from the in-gel tryptic digestion of BLT. The peptides correspond to (MH) + masses. Ion masses £ 1150 and ‡ 1600 Da are not shown. The marked products represent the peptides that characterize the BLT isoform with respect to BLCT isoform (peptides 167–180 and 188–201). Table 1. MALDI MS analysis of the peptide mixture extracted from BLT gel spot. MH + experimental MH + theoretical Peptide 2693.1 2693.7 162–187 2324.7 2324.1 41–61 1947.3 1947.9 202–220 1903.1 1903.5 62–76 230–245 1576.0 1576.3 113–126 1490.7 1490.5 167–180 1442.5 1442.1 88–100 1366.2 1365.7 188–201 1344.5 1344.4 150–161 1330.8 1330.4 77–87 1272.4 1271.9 88–99 1263.7 1263.1 139–149 1217.5 1217.0 150–160 1174.1 1174.5 127–137 1072.2 1072.0 12–19 1071.2 1071.0 1–11 1064.3 1064.5 138–146 909.1 909.2 139–146 680.4 680.9 23–26 Table 2. Specificity constants for the hydrolysis of model substrates by BLT and BLCT. Assay conditions were 0.1 M Tris/HCl, pH 8.0, and 25 °C. Enzyme concentration was 3 n M . Values were determined un- der pseudo first-order conditions and are the averages of four different experiments. SDs were £ 8% of the averages. Substrate 10 5 · k cat /K m ( M )1 Æs )1 ) BLT BLCT Boc-Gly-Lys-Arg-MCA 30 2.3 Boc-Gly-Gly-Arg-MCA 20 0.7 Boc-Phe-Ser-Arg-MCA 17 1.0 Boc-Val-Pro-Arg-MCA 18 0.5 Z-Arg-MCA 0.13 0.002 Table 3. Effect of serine protease inhibitors on BLT activity. Assay conditions were 0.1 M Tris/HCl, pH 8.0 and 30 °C. Residual activity was determined using Boc-Phe-Ser-Arg-MCA as substrate. BLT concentration was 5 n M active sites. Values are the averages of three determinations. Inhibitor Concentration % BLT activity None 0 100 DFP 2 m M 0 Benzamidine 2 m M 0 TLCK 2 m M 0 a-1-Antitrypsin 0.1 mgÆmL )1 96 STI 0.1 mgÆmL )1 100 BPTI (Aprotinin) 0.1 mgÆmL )1 35 514 A. Gambacurta et al. (Eur. J. Biochem. 270) Ó FEBS 2003 tissue, at the protein level and at the transcription level, as confirmed here. Here we describe isolation of a bovine tryptase gene and cDNA encoding a new tryptase isoform (BLT), which is in turn the only one isoform expressed in bovine lung. Furthermore, analysis of BLCT and BLT expression in bovine heart and spleen has shown that both enzymes are present in these tissues at the mRNA level. The simultaneous expression of the two isoforms could be due to similar regulatory mechanisms in these specific tissues. The coexistence in the same organism of multiple tryptase genes, as found here, is in linewith findings reported by others for human [23–26], and mouse [27,28] tryptases. What is peculiar here is the presence in the same organism of isoforms, BLCT and BLT, whose primary structure predicts a different functional efficiency, despite their 98% sequence identity, as confirmed by the catalytic activity of the isolated proteins (see also later). BLT differs from BLCT at only six of the 245 residues forming the catalytic domain, two of them (residues 188–189) being in sites thought to be critical determinants of function. BLT is structurally more similar than BLCT to most tryptases, in particular for the presence of the canonical residues Asp188 and Ser189 in the S1 specificity pocket, whereas residues Gly215 and Gly225, found in all b-type tryptases, are present in both the bovine enzymes. These results, indicating a possible tissue specific function of the two isoforms, prompted us to analyze the organiza- tion and the promoter sequences (Fig. 4) of the two tryptase genes. The length of both genes, as evaluated from the size of the PCR products, obtained from genomic DNA with proper primers, is around 1800 bp, similar to that of human bI tryptase gene [25]. The two genes share with human, dog and mouse MCP-6 tryptase genes the same organization with six exons separated by five introns, the same and unique position of intron I (189 bp), immediately upstream the initiation codon, and the location/phase of introns II–V. It is interesting to note that five codons (out of six) encoding different residues in BLT, with respect to BLCT, are all located in exon V, which encodes residues 137–191 of the mature proteins; this is the same region where the greatest disparity among human tryptases was found [26]. The prepro-sequences of BLT and BLCT (26 residues) are identical. Although four residue shorter, these sequences are very similar to the corresponding sequences of human a and bI-III tryptases [26]. Their C-terminal portions (10 residues) are identical to those of b tryptases, in agreement with their role as activation peptides. The presence of Arg in )3 position (relative to the mature proteins) is a key feature of b-like tryptases [26]. The 5¢ flanking regions (about 190 bp) of the BLT and BLCT genes (Fig. 4) are 70% identical; their last 100 bp are similar (about 60% identity) to the same regions of human bIandbII tryptase genes [25,26] and contain the same putative TATA box (ATAAA) in a similar position () 33/)32). BLCT also contains a canonical TATA box in an unusual position ()91) and a CAAT box at position )161. Both promoters contain a GC box (positions )68/)67) and other regulatory sequences (boxed in Fig. 4). In BLCT, binding sequences are present for positive transcription factors, such as APF and androgen receptors, AR [33]. APF is homologous to HNF-1 (hepatocyte nuclear factor I) which is responsible for the tissue specific activation of human a1-antitrypsin [34]. Likewise, BLT promoter contains several recognition sequences for positive transcription factors such as AR, NFIII (nuclear factor III) functionally identical to tran- scription factor OTF-1 [35], and AP-1, which is known to bind specific sequences present in promoters or enhancers [36]. The presence in both genes of AR sequences could suggest an hormone-regulated expression. Interestingly, the BLT promoter contains a recognition sequence for a negative transcription factor, COUP-TF (chick ovalbumin upstream promoter-transcription factor), which has been identified in many different species [37]. COUP-TFs belong to the steroid/thyroid hormone receptor (TR) superfamily and have been shown to down regulate the hormonal induction of TR-dependent activation of speci- fic genes, acting as inhibitors of transcriptional activity [37]. Thus, the interplay of positive or negative transcrip- tion factors may regulate, in a tissue-specific fashion, the expression of BLT and BLCT proteins. For the isolation of tryptase from lung we used a more acidic pH than that used in the liver capsule tryptase purification procedure, with the aim of increasing adsorp- tion of the enzyme to the resin and its stability. The heterogeneous sample needed to be purified by a further chromatographic step. However, some contaminating proteins were still present after this step, but the only serine protease detected by fluorography after labeling with radioactive DFP showed to be immunoreactive with specific anti-tryptase Igs. Our results show that in a gel chromato- graphy analysis of native BLT preincubated with heparin, theenzymeelutedasan 200 kDa protein. This size is in reasonable agreement with a tetramer bound to heparin [38] considering that the BLT monomer has a size of  35 kDa and that the elution position may be anticipated by the presence of the anionic heparin glycosamminoglycan. BLT subunit concentration was measured by burst tritation with MUGB. The procedure, whose success depends on the rapid acylation of the enzyme with release of a fluorescent leaving group followed by a very slow deacylation, was less satisfactory with BLCT. The instability of the guanidinobenzoyl-enzyme intermediate was probably due to the replacement of Asp188 with Asn in the S1 pocket of the protease. However, BLCT could be labeled with radioactive DFP, indicating that the catalytic machinery of the protease was functional [11,29]. In this regard, it is worthwhile to underscore the difference in specific activity between BLT and BLCT for the hydrolysis of Boc-Phe-Ser- Arg-MCA [870 and 190 pmol MCA min )1 Æ (pmol of tryptase subunit) )1 , respectively]. To investigate the structural features responsible for the functional differences between BLT and BLCT, we decided to support the sequence information obtained from cDNA analysis by protein sequence analysis. After column puri- fication, lung tryptase identified by SDS/PAGE was subjected to in-gel tryptic fragmentation followed by analysis of the peptide mixture by MALDI mass spectros- copy. Mass fingerprinting of BLT tryptic fragments allowed us to screen the entire protein sequence for the presence of peptides that characterize lung tryptase in comparison with the isoform isolated from liver capsule. Thepreferenceoftryptaseforcleavingsmallsynthetic substrates with two basic residues was previously suggested for human pituitary tryptase [2] and for BLCT [11,31]. In Ó FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 515 particular, the latter was shown to cleave peptide substrates that reproduce precursor sequences around putative clea- vage loci [31]. However, no conclusions can be drawn at this stage on the BLT preference for substrates with two terminal basic residues, in spite of the similar trend found in the catalytic efficiency of BLT and BLCT toward some synthetic substrates. Moreover, for all substrates examined, BLT exhibited k cat /K m values that were 10- to 60-fold greater than those of BLCT. The difference in catalytic properties between the two enzymes may be related to the sequence of the region forming the primary specificity S1 pocket. An Asp residue is located at position 188 in BLT, human, sheep and other tryptases and confers specificity for binding basic P1 amino acid residues. In BLCT, the presence of the Asn residue in that position results in a decrease negative charge at the bottom of the pocket and a consequent weaker interaction of substrates when compared with BLT and the other tryptases. The usual substrate specificity of BLCT was explained by assuming some conformational change of the active sites [29] and/or involving the role of additional interactions occurring between the active sites and substrates. In this regard, modeling studies showed that the carbonyl oxygen atom of the properly oriented Phe190 may form a hydrogen bond with the c-guanidino group of the P1 Arg residue in the inhibitor and/or substrate molecule [39]. Additional inter- actions in the interior of the extended substrate binding-site may also explain the consistently greater catalytic efficiency of BLT and BLCT on tripeptide substrates when compared with a single residue substrate. As to the inhibition by standard serine protease inactivators, it is worth mentioning that, similarly to BLCT [11,32], BLT is sensitive to aprotinin, the trypsin inhibitor of bovine origin. On the whole, the results reported in this study suggest a tissue-specific expression and a different competence for catalysis of BLT and BLCT. Thus, cattle could be a useful model for investigating heterogeneity of tryptases. Such heterogeneity is probably linked to different patterns of tryptase action following release from bovine mast cells in different tissues. The physiological meaning and the mech- anism underlying the differential expression of granule proteinases are not yet fully understood for humans, rodents, dog and sheep mast cells [40]. It is interesting to recall that in rat lung, chymase expression is modified by nematode infection [41]. It may be argued that the role of tissue microenvironment on mast cell phenotype must be linked to proteinase function in the various tissues. As yet, there are no obvious clues as to why such mechanism may be correlated to different in vivo functions. Further studies are required to explore the role of bovine tryptases and to identify their target substrates. Acknowledgements This investigation was supported by MURST and MURST-CNR Biotechnology Program L.95/95, Italy. References 1. Smith, T.J., Houghl, M.W. & Johnson, D.A. (1984) Human lung tryptase: purification and characterization. J. Biol. Chem. 259, 11046–11051. 2. Cromlish, J.A., Seidah, N.G., Marcinkiewicz, M., Hamelin, J., Johnson, D.A. & Chretien, M. (1987) Human pituitary tryptase: molecular forms, NH 2 -terminal sequence, immunocytochemical localization and specificity with prohormone and fluorogenic substrates. J. Biol. Chem. 262, 1363–1373. 3. Harvima, I.T., Schechter, N.M., Harvima, R.J. & Fraki, J.E. (1988) Human skin tryptase: purification, partial characterization andcomparisonwithhumanlungtryptase.Biochim. Biophys. Acta 957, 71–80. 4. Caughey, G.H., Viro, N.F., Ramachandran, J., Lazarus, S.C., Borson, D.B. & Nadel, J.A. (1987) Dog mastocytoma tryptase: affinity purification, characterization and amino-termoinal sequence. Arch. Biochem. Biophys. 258, 555–563. 5. Vanderslice, P., Craik, C.S., Nadel, J.A. & Caughey, G.H. (1989) Molecular cloning of dog mast cell tryptases and a related pro- tease:structuralevidenceofauniquemodeofserineprotease activation. Biochemistry 28, 4148–4155. 6. Ide, H., Itoh, H., Tomita, M., Murakumo, Y., Kobayashi, T., Maruyama, H., Osada, Y. & Nawa, Y. (1995) Molecular cloning and expression of rat mast cell tryptase. J. Biochem. (Tokyo) 118, 210–215. 7. Kido, H., Fukusen, N. & Katunuma, N. (1985) Chymotrypsin and trypsin-type serine proteases in rat mast cells: properties and functions. Arch. Biochem. Biophys. 239, 436–443. 8. Braganza, V.J. & Simmons, W.H. (1991) Tryptase from rat skin: purification and properties. Biochemistry 30, 4997–5007. 9. Reynolds, D.S., Gurley, D.S., Austen, K.F. & Serafin, W.E. (1991) Cloning of cDNA and gene of mouse mast cell protease-6. J. Biol. Chem. 266, 3847–3853. 10. Mc. Neil, H.P., Reynolds, D.S., Schiller, V., Ghildyal, N., Gurley, D.S., Austen, K.F. & Stevens, R.L. (1992) Isolation, characteri- zation and transcription of the gene encoding mouse mast cell protease 7. Proc. Natl Acad. Sci. USA 89, 11174–11178. 11. Fiorucci, L., Erba, F. & Ascoli, F. (1992) Bovine tryptase: puri- fication and characterization. Biol. Chem. Hoppe-Seyler 373, 483–490. 12. Murakumo,Y.,Ide,H.,Itoh,H.,Tomita,M.,Kobayashi,T., Maruyama, H., Horii, Y. & Nawa, Y. (1995) Cloning of the cDNA encoding mast cell tryptase of Mongolian gerbil, Meriones unguiculatus, and its preferential expression in the intestinal mucosa. Biochem. J. 309, 921–926. 13. Pemberton, A.D., McAleese, S.M., Huntley, J.F., Collie, D.D.S., Scudamore, C.L., McEuen, A.R., Walls, A.F. & Miller, H.R.P. (2000) cDNA sequence of two sheep mast cell tryptases and the differential expression of tryptase and sheep mast cell proteinase-1 in lung, dermis and gastrointestinal tract. Clin. Exper. Allergy 30, 818–832. 14. Schwartz, L.B., Bradford, T.R., Litman, B.L. & Wintroub, B.U. (1985) The fibrinogenolytic activity of purified tryptase from human lung mast cells. J. Immunol. 135, 2762–2767. 15. Caughey, G.H., Leidig, F., Viro, N.F., Gold, W.M. & Nadel, J.A. (1988) Substance P and vasointestinal peptide degradation by mast cell tryptase and chymase. J. Pharmacol. Exp. Ther. 244, 133–137. 16. Ruoss, S.J., Hartmann, T. & Caughey, G.H. (1991) Mast cell tryptase is a mitogen for cultured fibroblasts. J. Clin. Invest. 88, 493–499. 17. Stack, M.S. & Johnson, D.A. (1994) Human mast cell tryptase activates single chain urinary-type plasminogen activator (pro-urokinase). J. Biol. Chem. 269, 9416–9419. 18. Blair, R.J., Meng, H., Marchese, M.J., Ren, S., Schwartz, L.B., Tonnesen, M.G. & Gruber, B.L. (1997) Human mast cells stimulate vascular tube formation: tryptase is a novel, potent angiogenic factor. J. Clin. Invest. 99, 2691–2700. 19. Steinhoff, M., Vergnolle, N., Young, S.H., Tognetto, M., Amadesi, S., Ennes, H.S., Trevisani, M., Hollenberg, M.D., 516 A. Gambacurta et al. (Eur. J. Biochem. 270) Ó FEBS 2003 [...]... Stevens, R.L & Nadeau, J.H (1994) Location of the mouse mast cell protease 7 gene (MCP7) to chromosome 17 Mammal Genome 5, 656–657 Pallaoro, M., Gambacurta, A., Fiorucci, L., Mignogna, G., Barra, D & Ascoli, F (1996) cDNA cloning and primary structure of tryptase from bovine mast cells, and evidence for the expression of bovine pancreatic trypsin inhibitor mRNA in the same cells Eur J Biochem 237, 100–105... Tissue- specific expression of bovine tryptases (Eur J Biochem 270) 517 Wallace, J.L., Caughey, G.H., Mitchell, S.E., Williams, L.M., Geppetti, P., Mayer, E.A & Bunnett, N.W (2000) Agonists of proteinase-activated receptor 2 induce inflammation by a neurogenic mechanism Nat Med 6, 151–158 Schwartz, L.B & Bradford, T.R (1986) Regulation of tryptase from human lung mast cells by heparin: stabilization of. .. (1989) Cloning and characterization of complementary DNA for human tryptase J Clin Invest 84, 1188–1195 Miller, J.S., Moxley, G & Schwartz, L.B (1990) Cloning and characterization of a second complementary DNA for human tryptase J Clin Invest 86, 864–870 Vanderslice, P., Ballinger, S.M., Tam, E.K., Goldstein, S.M., Craik, C.S & Caughey, G.H (1990) Human mast cell tryptase: multiple cDNAs and genes reveal... inhibitors of mast cell tryptase Biochemistry 40, 7342–7349 39 Erba, F., Fiorucci, L., Pascarella, S., Menegatti, E., Ascenzi, P & Ascoli, F (2001) Selective inhibition of human mast cell tryptase by gabexate mesylate, an antiproteinase drug Biochem Pharmacol 61, 271–276 40 Miller, H.R & Pemberton, A.D (2002) Tissue- specific expression of mast cell granule serine proteinases and their role in inflammation in the. .. Adams, R.W., Kyle, W.S & Elmore, D.T (1973) Determination of the operational molarity of solutions of bovine alpha-chymotrypsin, trypsin, thrombin and factor Xa by spectrofluorimetric titration Biochem J 131, 107– 117 31 Fiorucci, L., Pallaoro, M., Erba, F., Colombo, A.P., Rholam, M., Cohen, P & Ascoli, F (1998) Structural and functional properties of Bos taurus tryptase: a search for a possible propeptide... binding sites in bovine tryptase FEBS Lett 363, 81–84 33 Faber, P.W., van Rooij, H.C., van der Korput, H.A., Baarends, W.M., Brinkmann, A.O., Grootegoed, J.A & Trapman, J (1991) Characterization of the human androgen receptor transcription unit J Biol Chem 266, 10743–10749 34 Monaci, P., Nicosia, A & Cortese, R (1988) Two different liverspecific factors stimulate in vitro transcription from the human a1-antitrypsin... cell granule serine proteinases and their role in inflammation in the lung and gut Immunology 105, 375–390 41 Tomita, M., Itoh, H., Kobayashi, T., Onitsuka, T & Nawa, Y (1999) Expression of mast cell proteases in rat lung during helminth infection: mast cells express both rat mast cell protease II and tryptase in helminth infected lung Int Arch Allergy Immunol 120, 303–309 42 Huang, R., Abrink, M.,... Fejzo, M.S., Shayesteh, L., Blount, J.L & Caughey, G.H (1999) Characterization of genes encoding known and novel human mast cell tryptases on chromosome 16p13.3 J Biol Chem 274, 3355–3362 Gurish, M.F., Nadeau, J.H., Johnson, K.R., McNeil, H.P., Grattan, K.M., Austen, K.F & Stevens, R.L (1993) A closely linked complex of mouse mast cell -specific chymase genes on chromosome 14 J Biol Chem 268, 11372–11379... lung Int Arch Allergy Immunol 120, 303–309 42 Huang, R., Abrink, M., Gobl, A.E., Nilsson, G., Aveskogh, M., Larsson, L.G., Nilsson, K & Hellman, L (1993) Expression of a mast cell tryptase in the human monocytic cell lines U-937 and Mono Mac 6 Scand J Immunol 38, 359–367 ... to the DNA replication factor NF-III Science 241, 1210–1213 36 Bohmann, D., Bos, T.J., Admon, A., Nishimura, T., Vogt, P.K & Tjian, R (1987) Human proto-oncogene c-jun encodes a DNA binding protein with structural and functional properties of transcription factor AP-1 Science 238, 1386–1392 37 Tsai, S.Y & Tsai, M.J (1997) Chick ovalbumin upstream promoter-transcription factors (COUP-TFs): coming of . Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform Alessandra Gambacurta 1 *, Laura. Some evidence on tissue- specific expression of the two isoforms in different bovine tissues is also reported and in this light the different sequence of the two