... analysis was used for categorical data and continuous data was analyzed using non-parametric tests Statistical significance was defined as 5% level Results 63 childrenand adolescents aged to 18 years ... for affective disordersand schizophrenia Arch Gen Psychiatry 1978, 35:837-844 Mohammadi MR, Ghanizadeh A, Rahgozar M, Noorbala AA, Davidian H, Malekafzali H, Naghavi HR, Baghery Yazi SA, Saberi ... Naghavi HR, Pouretemad HR, Yazdi SA, Rahgozar M, Alaghebandrad J, Amini H, Razzaghi EM, Mesgarpour B, Soori H, Mohammadi M, Ghanizadeh A: An epidemiological survey of psychiatric disordersin Iran...
... rigidity, and dysarthria, hypophonia, and sialorrhea may have a similar mechanism Other manifestations of bradykinesia are micrographia, decreased blink rate, loss of arm swing, and shuZing gait Respiratory ... Xuctuating response and On–OV phenomena) is characterized by increasing disabilities and partial dependence for most ADLs such as eating, dressing, and washing All cardinal symptoms of the disease ... symptomatic treatment for PD L-dopa is converted to dopamine by central dopadecarboxylase, stored in dopamine neurons, and released to the synaptic space to act on dopamine receptors Carbidopa and...
... Research,” in The Human-Computer Interaction Handbook: Fundamentals, Evolving Technologies, and Emerging Applications, A Sears and J A Jacko, Eds., Human Factors and Ergonomics, Lawrence Erlbaum ... manner also equal-appearing scales such as Likert scales are reliably examined ina statistical regression analysis Other agreement measures, for example, Cohen’s Kappa or Alpha, were not used in ... (DIA) was applied to the speech data to measure the phoneme intelligibility In the dysarthric speech data, they obtain correlations between the perceptual evaluation and their automatic measure...
... in knowing how to elicit WTP values in an African context can refer to Kirigia, Sambo and Kainyu [15] (b) Use of casual-labour wage rate to value lost labour time A casual-labour wage rate of ... sectors and occupations of patients and relatives; and D each patient and the two accompanying adults will spend a total of hours each, i.e including seeking doctor's/magistrate's recommendation ... waiting for admission, and during institutionalized treatment; by relatives accompanying patients during pre-admission consultations, travel toand from hospitals accompanying patient(s), waiting...
... mucosa, as well A change in channel activity leading toa cataract brings together such distant disorders as schizophrenia and myotonic dystrophy [60] Both carry an increased risk of cataract, ... troubling, it appears to be associated with an intriguing gain in having reduced physiological and pathological proliferation capacity and thus a diminished oncogenic potential [84] A population-based ... Likewise, apamin increased neuronal excitability and facilitated the induction of synaptic plasticity at Schaffer collateral synapses and hippocampaldependent learning [26] Mice treated with apamin...
... Germany.) This was followed by incubation with rabbit anti-mouse IgG (DAKO A/ S), and an alkaline phosphatase/anti-alkaline phosphatase complex (DAKO A/ S) Immune complexes containing alkaline ... photosensitive skin rash, an autoimmune haemolytic anaemia, lymphopaenia, thrombocytopaenia, and homogeneous antinuclear antibodies characterized as anti-DNA antibodies At the time of splenectomy the patient ... splenectomy the patient had detectable antibodies against DNA (Crithidia negative), and IgA and IgM antibodies against cardiolipin The spleen was cut into small pieces and snap frozen Serial frozen sections...
... population The GP characteristics include demographic data, interest and attitudes towards depressive and anxiety disorders, and questions to assess barriers to healthcare provision to patients with ... costs are (a) the costs per hour of the GP visitor and experts for the activities during the tailoring process and the one-day training and feedback, (b) material costs for the one-day training, and ... stepped-care treatment allocation, and providing of information on the diagnosis and stepped-care treatment options for anxiety and depressive disorders, a semistructured face -to- face interview was carried...
... authorship CKC and RH carried out the data retrieval, statistical analyses, and manuscript drafting AF, MB, WL and RS participated in the hypothesis generation, data management, and assistant on manuscript ... = 501)* # Compared to the population of England and Wales in 2008 * P-value < 0.05 all major causes, including cardiovascular diseases (heart attack and stroke) [11] These may be influenced by ... a widening mortality gap over recent decades with the pattern of change suggesting a failure to benefit from population improvements in health rather than an actual increased case fatality rate...
... et al 1995[20] Abdel-Hakim 1996[38] Al Amoudi et al 1998[5] Farsi N 1999[6] Thilander et al 2002[23] Farsi N 2003[7] Feteih 2005 † Japan USA China S Arabia S Arabia S Arabia Bogota S Arabia S Arabia ... females and 155 males) Clinical examination The examination was carried out by two examiners from the department of Preventive Oral Sciences, an Orthodontist anda Paediatric Dentist Inter and intra ... temporomandibular disordersand oral parafunctions among Saudi children J Oral Rehabil 2003, 30:1200-1208 Jagger R, Wood C: Signs and symptoms of temporomandibular joint dysfunction ina Saudi Arabian...
... (absent) to (severe and constant) Raters were trained on the ESRS using training tapes at a multicenter investigators' meeting held to standardize procedures Investigators and/ or designated raters ... equal or 1) ESRS score assignments of mild as a rating of or and moderate as a rating of on the physician's examination for dyskinesia subscale were based on a prior analysis [27] Data analysis ... mental retardation [20] or borderline intellectual functioning with an IQ of ≥ 36 and ≤ 84; anda Vineland Adaptive Behavior Scale score ≤ 84 [25] Subjects had to be healthy, and aged between and 12...
... ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA ... AK LF AK SF AK LR AK SR eIF 4A LF eIF 4A SF eIF 4A LR eIF 4A SR CAATCCATCAAAACCGTGTG TGCTACAGCAACTGGTGATCAGAAGGG CCCTTCCTGATCACCATGTTGCTGT GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ... CHH involvement in response to stress in other crustacean species, it is reasonable to think that Cal sapidus CHH may also play an important regulatory role in adaptation to naturally occurring...
... (labiodental) /f/ and /v/ Teeth (interdental) /θ/ and / ð/ Tooth ridge (alveolar) /s/ and /z/ Hard palate (alveolar palate) /∫ /and / Ȝ / Bilabial Labiodentals Interdental Alveolar f θ s 22 Alveopalatal ... terms of place of articulation, manner of articulation, and voicing: Labial Apical Dorsa Radia Glottal l Dent Stop Noisy c k Palata al l l Aspirate th Un- t Vs aspira V b d 30 t te Nasal sonant d ... Depending on preference, anything can be used to good advantage Reading aloud is a classroom activity which has fallen inand out of favour with teachers at various times The main argument against...
... to the real world and lose his illusions This idea is very similar in nature to Plato's allegory The Cave In this allegory humans are trapped ina cave and can see no light They are unaware of ... waging a war against A. I run rampant, the creators of that AI were their own ancestors Star Wars is decidedly less complex, and doesn't bother to give us much back-story; the Rebels are good and ... given a medal at a grand ceremony for his help in defeating the Empire Neo makes a phone call to the machines with a threat that seemingly gives the machine a moment of pause Elements of Distinction...
... Tanzania mainland The target population was all finalist degree programme students in 20 degree programmes at SUA in the 2010/2011 academic year A simple random sampling technique was used to ... language -in- education (Tibategeza, 2009; Swila, 2009; Rugemalira, 2005; Rubagumya, 1991; Mlama and Materu, 1978) have advocated a switch to Kiswahili as a language of instruction at all levels of education insisting ... Criper, and an administrator, Mr Dodd The findings of this study indicated that “education standards were falling, and teachers’ and students’ knowledge of and proficiency in English was low” (Malekela,...
... economies/regions in the GTAP database Vietnam Singapore Indonesia, Malaysia, Philippines, Thailand Brunei, Cambodia, Lao PDR, Myanmar China and Hong Kong Japan Korea Taiwan Australia United States Austria, ... ASEAN Free Trade Area (AFTA) As ASEAN progresses with new trade and economic cooperation arrangements, notably with China, Japan, Korea, Australia and New Zealand and India, Vietnam has been part ... change in welfare or GDP, gains for ASEAN countries and Korea are found to be generally larger than that for China and Japan Using GTAP simulations, Urata and Kiyota (2003) indicates that ASEAN+3...
... additional rhs U , is now the singular part transformation (46), and the scalar(s) ψ to which the scalar(s) τ are linked by (47) are assumed to satisfy a linear system, the Lax pair Another interesting ... carefully edited and closely related to each other Each contribution should contain at least partly original and previously unpublished material, be written ina clear, pedagogical style and aimed ... must satisfy the Tzitz´ica PDE, and f0 is an arbitrary e nonzero complex constant λ Accordingly, one has obtained a Lax pair anda singular part transformation The equivalent projective Riccati...
... Page of Figure Mean with the standard error bars of measured Caspase3, IL6 and TNFa (a) , Ca2+, Mg2+ and Ca2+/Mg2+(b), and Na+, K+ and Na+/K+(c) in autistic patients (N = 25) compared to age and ... impaired Ca 2+ and K + concentrations in plasma of autistic patients could be easily related to the postulated increase of brain cytokines (TNFa and IL6) after infiltration from plasma to brain ... These information initiate our interest to measure concentrations of Na+, K+, Ca2+, Mg2+ together with caspase3 as a proapoptotic marker, IL6 and TNFa as proinflammation markers in the plasma of autistic...
... with amalgam that was manually mixed ina mortar? yes-no Have you ever manually weighted mercury and alloy and mixed it ina mortar? If yes: In that case, when and for how many years? From year to ... expressed as kappa statistics between the questionnaire and the interview in regard to ever having used copper amalgam, performed manual mixing ina mortar, and used a Dentomat Taking the answers ... year Have you mixed amalgam ina Dentomat? Yes-no Did you use a Dentomat (semi-automatic device) to prepare amalgam? If yes: In what time period did you this: In that case, when and for how many...
... stability against torsional loads due to the increase in contact area of the porous coating The 18 mm diameter stem demonstrated a wide variability in torsional stability at the minimal cm diaphyseal ... may be inadequate against the peak in vivo torsional loads experienced during activities such as walking and stair climbing Ina report on in vivo torsional loads via a telemeterized total hip ... investigation protocol and assisted with drafting the manuscript JJJ, WGP and AGR participated in the investigation concept and design, as well as assisted with manuscript preparation and drafting...
... HIV/AIDS and their attitude and behavior toward persons with the disease The instrument included sections on background characteristics, sexual behaviors, and condom use Data Analyses The data ... • To determine the knowledge, attitudes, and risk behaviors of diabetic patients in regard to HIV/AIDS; and • To compare these groups on these parameters and make conclusions as to how best to ... is making the desired impact with regard to information about HIV/AIDS in Nigeria The impact of healthcare providers/institutions in the dissemination of information on HIV/AIDS issues was rather...