behavioral and somatic disorders in children exposed in utero to synthetic hormones a testimony
Báo cáo y học: "Association of nail biting and psychiatric disorders in children and their parents in a psychiatrically referred sample of children" ppsx
... analysis was used for categorical data and continuous data was analyzed using non-parametric tests Statistical significance was defined as 5% level Results 63 children and adolescents aged to 18 years ... for affective disorders and schizophrenia Arch Gen Psychiatry 1978, 35:837-844 Mohammadi MR, Ghanizadeh A, Rahgozar M, Noorbala AA, Davidian H, Malekafzali H, Naghavi HR, Baghery Yazi SA, Saberi ... Naghavi HR, Pouretemad HR, Yazdi SA, Rahgozar M, Alaghebandrad J, Amini H, Razzaghi EM, Mesgarpour B, Soori H, Mohammadi M, Ghanizadeh A: An epidemiological survey of psychiatric disorders in Iran...
- 7
- 377
- 0
Psychiatric and Cognitive Disorders in Parkinson’s Disease pptx
... rigidity, and dysarthria, hypophonia, and sialorrhea may have a similar mechanism Other manifestations of bradykinesia are micrographia, decreased blink rate, loss of arm swing, and shuZing gait Respiratory ... Xuctuating response and On–OV phenomena) is characterized by increasing disabilities and partial dependence for most ADLs such as eating, dressing, and washing All cardinal symptoms of the disease ... symptomatic treatment for PD L-dopa is converted to dopamine by central dopadecarboxylase, stored in dopamine neurons, and released to the synaptic space to act on dopamine receptors Carbidopa and...
- 241
- 273
- 1
báo cáo hóa học:" Research Article Automatic Speech Recognition Systems for the Evaluation of Voice and Speech Disorders in Head and Neck Cancer" pdf
... Research,” in The Human-Computer Interaction Handbook: Fundamentals, Evolving Technologies, and Emerging Applications, A Sears and J A Jacko, Eds., Human Factors and Ergonomics, Lawrence Erlbaum ... manner also equal-appearing scales such as Likert scales are reliably examined in a statistical regression analysis Other agreement measures, for example, Cohen’s Kappa or Alpha, were not used in ... (DIA) was applied to the speech data to measure the phoneme intelligibility In the dysarthric speech data, they obtain correlations between the perceptual evaluation and their automatic measure...
- 7
- 566
- 0
Báo cáo y học: "Cost of mental and behavioural disorders in Kenya" ppt
... in knowing how to elicit WTP values in an African context can refer to Kirigia, Sambo and Kainyu [15] (b) Use of casual-labour wage rate to value lost labour time A casual-labour wage rate of ... sectors and occupations of patients and relatives; and D each patient and the two accompanying adults will spend a total of hours each, i.e including seeking doctor's/magistrate's recommendation ... waiting for admission, and during institutionalized treatment; by relatives accompanying patients during pre-admission consultations, travel to and from hospitals accompanying patient(s), waiting...
- 7
- 409
- 0
Báo cáo y học: "Phobic memory and somatic vulnerabilities in anorexia nervosa: a necessary unity" ppsx
... mucosa, as well A change in channel activity leading to a cataract brings together such distant disorders as schizophrenia and myotonic dystrophy [60] Both carry an increased risk of cataract, ... troubling, it appears to be associated with an intriguing gain in having reduced physiological and pathological proliferation capacity and thus a diminished oncogenic potential [84] A population-based ... Likewise, apamin increased neuronal excitability and facilitated the induction of synaptic plasticity at Schaffer collateral synapses and hippocampaldependent learning [26] Mice treated with apamin...
- 10
- 460
- 0
Báo cáo y học: "The VH gene repertoire of splenic B cells and somatic hypermutation in systemic lupus erythematosus" potx
... Germany.) This was followed by incubation with rabbit anti-mouse IgG (DAKO A/ S), and an alkaline phosphatase/anti-alkaline phosphatase complex (DAKO A/ S) Immune complexes containing alkaline ... photosensitive skin rash, an autoimmune haemolytic anaemia, lymphopaenia, thrombocytopaenia, and homogeneous antinuclear antibodies characterized as anti-DNA antibodies At the time of splenectomy the patient ... splenectomy the patient had detectable antibodies against DNA (Crithidia negative), and IgA and IgM antibodies against cardiolipin The spleen was cut into small pieces and snap frozen Serial frozen sections...
- 8
- 378
- 0
báo cáo khoa học: "Randomised controlled trial of tailored interventions to improve the management of anxiety and depressive disorders in primary care" pdf
... population The GP characteristics include demographic data, interest and attitudes towards depressive and anxiety disorders, and questions to assess barriers to healthcare provision to patients with ... costs are (a) the costs per hour of the GP visitor and experts for the activities during the tailoring process and the one-day training and feedback, (b) material costs for the one-day training, and ... stepped-care treatment allocation, and providing of information on the diagnosis and stepped-care treatment options for anxiety and depressive disorders, a semistructured face -to- face interview was carried...
- 8
- 375
- 0
Báo cáo y học: " All-cause mortality among people with serious mental illness (SMI), substance use disorders, and depressive disorders in southeast London: a cohort study" ppsx
... authorship CKC and RH carried out the data retrieval, statistical analyses, and manuscript drafting AF, MB, WL and RS participated in the hypothesis generation, data management, and assistant on manuscript ... = 501)* # Compared to the population of England and Wales in 2008 * P-value < 0.05 all major causes, including cardiovascular diseases (heart attack and stroke) [11] These may be influenced by ... a widening mortality gap over recent decades with the pattern of change suggesting a failure to benefit from population improvements in health rather than an actual increased case fatality rate...
- 7
- 272
- 0
báo cáo khoa học:" Signs and symptoms of temporomandibular disorders and oral parafunctions in urban Saudi arabian adolescents: a research report" docx
... et al 1995[20] Abdel-Hakim 1996[38] Al Amoudi et al 1998[5] Farsi N 1999[6] Thilander et al 2002[23] Farsi N 2003[7] Feteih 2005 † Japan USA China S Arabia S Arabia S Arabia Bogota S Arabia S Arabia ... females and 155 males) Clinical examination The examination was carried out by two examiners from the department of Preventive Oral Sciences, an Orthodontist and a Paediatric Dentist Inter and intra ... temporomandibular disorders and oral parafunctions among Saudi children J Oral Rehabil 2003, 30:1200-1208 Jagger R, Wood C: Signs and symptoms of temporomandibular joint dysfunction in a Saudi Arabian...
- 7
- 283
- 0
Báo cáo y học: "Evaluating movement disorders in pediatric patients receiving risperidone: a comparison of spontaneous reports and research criteria for TD" pot
... (absent) to (severe and constant) Raters were trained on the ESRS using training tapes at a multicenter investigators' meeting held to standardize procedures Investigators and/ or designated raters ... equal or 1) ESRS score assignments of mild as a rating of or and moderate as a rating of on the physician's examination for dyskinesia subscale were based on a prior analysis [27] Data analysis ... mental retardation [20] or borderline intellectual functioning with an IQ of ≥ 36 and ≤ 84; and a Vineland Adaptive Behavior Scale score ≤ 84 [25] Subjects had to be healthy, and aged between and 12...
- 9
- 332
- 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot
... ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA ... AK LF AK SF AK LR AK SR eIF 4A LF eIF 4A SF eIF 4A LR eIF 4A SR CAATCCATCAAAACCGTGTG TGCTACAGCAACTGGTGATCAGAAGGG CCCTTCCTGATCACCATGTTGCTGT GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ... CHH involvement in response to stress in other crustacean species, it is reasonable to think that Cal sapidus CHH may also play an important regulatory role in adaptation to naturally occurring...
- 12
- 474
- 0
An analysis on consonants in english and their comparison in Vietnamese to improve pronouncitation
... (labiodental) /f/ and /v/ Teeth (interdental) /θ/ and / ð/ Tooth ridge (alveolar) /s/ and /z/ Hard palate (alveolar palate) /∫ /and / Ȝ / Bilabial Labiodentals Interdental Alveolar f θ s 22 Alveopalatal ... terms of place of articulation, manner of articulation, and voicing: Labial Apical Dorsa Radia Glottal l Dent Stop Noisy c k Palata al l l Aspirate th Un- t Vs aspira V b d 30 t te Nasal sonant d ... Depending on preference, anything can be used to good advantage Reading aloud is a classroom activity which has fallen in and out of favour with teachers at various times The main argument against...
- 67
- 694
- 2
star wars and the matrix in relation to the heros quest
... to the real world and lose his illusions This idea is very similar in nature to Plato's allegory The Cave In this allegory humans are trapped in a cave and can see no light They are unaware of ... waging a war against A. I run rampant, the creators of that AI were their own ancestors Star Wars is decidedly less complex, and doesn't bother to give us much back-story; the Rebels are good and ... given a medal at a grand ceremony for his help in defeating the Empire Neo makes a phone call to the machines with a threat that seemingly gives the machine a moment of pause Elements of Distinction...
- 2
- 405
- 0
Comparison between students’ academic performance and their abilities in written English language skills: A Tanzanian perspective ppt
... Tanzania mainland The target population was all finalist degree programme students in 20 degree programmes at SUA in the 2010/2011 academic year A simple random sampling technique was used to ... language -in- education (Tibategeza, 2009; Swila, 2009; Rugemalira, 2005; Rubagumya, 1991; Mlama and Materu, 1978) have advocated a switch to Kiswahili as a language of instruction at all levels of education insisting ... Criper, and an administrator, Mr Dodd The findings of this study indicated that “education standards were falling, and teachers’ and students’ knowledge of and proficiency in English was low” (Malekela,...
- 21
- 669
- 0
Tác động của hội nhập khu vực đông á tới phúc lợi và sản lượng ngành của việt nam - Regional Integration in East Asia and Its Impacts on Welfare and Sectoral Output in Vietnam To Minh Thu
... economies/regions in the GTAP database Vietnam Singapore Indonesia, Malaysia, Philippines, Thailand Brunei, Cambodia, Lao PDR, Myanmar China and Hong Kong Japan Korea Taiwan Australia United States Austria, ... ASEAN Free Trade Area (AFTA) As ASEAN progresses with new trade and economic cooperation arrangements, notably with China, Japan, Korea, Australia and New Zealand and India, Vietnam has been part ... change in welfare or GDP, gains for ASEAN countries and Korea are found to be generally larger than that for China and Japan Using GTAP simulations, Urata and Kiyota (2003) indicates that ASEAN+3...
- 23
- 632
- 0
conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.
... additional rhs U , is now the singular part transformation (46), and the scalar(s) ψ to which the scalar(s) τ are linked by (47) are assumed to satisfy a linear system, the Lax pair Another interesting ... carefully edited and closely related to each other Each contribution should contain at least partly original and previously unpublished material, be written in a clear, pedagogical style and aimed ... must satisfy the Tzitz´ica PDE, and f0 is an arbitrary e nonzero complex constant λ Accordingly, one has obtained a Lax pair and a singular part transformation The equivalent projective Riccati...
- 287
- 805
- 0
báo cáo hóa học: " Proinflammatory and proapoptotic markers in relation to mono and di-cations in plasma of autistic patients from Saudi Arabia" docx
... Page of Figure Mean with the standard error bars of measured Caspase3, IL6 and TNFa (a) , Ca2+, Mg2+ and Ca2+/Mg2+(b), and Na+, K+ and Na+/K+(c) in autistic patients (N = 25) compared to age and ... impaired Ca 2+ and K + concentrations in plasma of autistic patients could be easily related to the postulated increase of brain cytokines (TNFa and IL6) after infiltration from plasma to brain ... These information initiate our interest to measure concentrations of Na+, K+, Ca2+, Mg2+ together with caspase3 as a proapoptotic marker, IL6 and TNFa as proinflammation markers in the plasma of autistic...
- 9
- 413
- 0
báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx
... with amalgam that was manually mixed in a mortar? yes-no Have you ever manually weighted mercury and alloy and mixed it in a mortar? If yes: In that case, when and for how many years? From year to ... expressed as kappa statistics between the questionnaire and the interview in regard to ever having used copper amalgam, performed manual mixing in a mortar, and used a Dentomat Taking the answers ... year Have you mixed amalgam in a Dentomat? Yes-no Did you use a Dentomat (semi-automatic device) to prepare amalgam? If yes: In what time period did you this: In that case, when and for how many...
- 8
- 422
- 0
báo cáo hóa học:" Stem diameter and rotational stability in revision total hip arthroplasty: a biomechanical analysis" ppt
... stability against torsional loads due to the increase in contact area of the porous coating The 18 mm diameter stem demonstrated a wide variability in torsional stability at the minimal cm diaphyseal ... may be inadequate against the peak in vivo torsional loads experienced during activities such as walking and stair climbing In a report on in vivo torsional loads via a telemeterized total hip ... investigation protocol and assisted with drafting the manuscript JJJ, WGP and AGR participated in the investigation concept and design, as well as assisted with manuscript preparation and drafting...
- 7
- 449
- 0
báo cáo hóa học:" A Comparative Study of HIV/AIDS: The Knowledge, Attitudes, and Risk Behaviors of Schizophrenic and Diabetic Patients in Regard to HIV/AIDS in Nigeria" doc
... HIV/AIDS and their attitude and behavior toward persons with the disease The instrument included sections on background characteristics, sexual behaviors, and condom use Data Analyses The data ... • To determine the knowledge, attitudes, and risk behaviors of diabetic patients in regard to HIV/AIDS; and • To compare these groups on these parameters and make conclusions as to how best to ... is making the desired impact with regard to information about HIV/AIDS in Nigeria The impact of healthcare providers/institutions in the dissemination of information on HIV/AIDS issues was rather...
- 6
- 556
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25